ID: 1009566204

View in Genome Browser
Species Human (GRCh38)
Location 6:65313991-65314013
Sequence CAGCAAGGCTGGAGGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2179
Summary {0: 2, 1: 0, 2: 7, 3: 140, 4: 2030}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009566204 Original CRISPR CAGCAAGGCTGGAGGGGAGT GGG (reversed) Intronic
Too many off-targets to display for this crispr