ID: 1009566797

View in Genome Browser
Species Human (GRCh38)
Location 6:65320556-65320578
Sequence GTGCCACTTGAATACGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 40}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009566797_1009566802 13 Left 1009566797 6:65320556-65320578 CCTTGAACGTATTCAAGTGGCAC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 1009566802 6:65320592-65320614 AAGTGGATCCAAGTGGCACATGG 0: 2
1: 0
2: 4
3: 22
4: 138
1009566797_1009566800 6 Left 1009566797 6:65320556-65320578 CCTTGAACGTATTCAAGTGGCAC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 1009566800 6:65320585-65320607 CTCCTTGAAGTGGATCCAAGTGG 0: 2
1: 0
2: 1
3: 8
4: 115
1009566797_1009566803 14 Left 1009566797 6:65320556-65320578 CCTTGAACGTATTCAAGTGGCAC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 1009566803 6:65320593-65320615 AGTGGATCCAAGTGGCACATGGG 0: 2
1: 0
2: 0
3: 13
4: 106
1009566797_1009566806 25 Left 1009566797 6:65320556-65320578 CCTTGAACGTATTCAAGTGGCAC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 1009566806 6:65320604-65320626 GTGGCACATGGGATAGATGGTGG 0: 2
1: 0
2: 0
3: 19
4: 167
1009566797_1009566805 22 Left 1009566797 6:65320556-65320578 CCTTGAACGTATTCAAGTGGCAC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 1009566805 6:65320601-65320623 CAAGTGGCACATGGGATAGATGG No data
1009566797_1009566799 -4 Left 1009566797 6:65320556-65320578 CCTTGAACGTATTCAAGTGGCAC 0: 1
1: 0
2: 1
3: 3
4: 40
Right 1009566799 6:65320575-65320597 GCACATTTGGCTCCTTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009566797 Original CRISPR GTGCCACTTGAATACGTTCA AGG (reversed) Intronic
903468084 1:23566447-23566469 GGGCCACTTGATTACACTCAGGG - Intergenic
904778455 1:32926224-32926246 GCGCCACCTGAAGACGTTCCAGG - Intergenic
910328345 1:86038428-86038450 GTACCACTTAAAAACCTTCATGG + Intronic
911285808 1:95991037-95991059 TTGCCACAGGAATACTTTCAAGG + Intergenic
920361668 1:205421888-205421910 GTGCCACTTGAAATTGTTGAGGG - Intronic
921818873 1:219594063-219594085 GCGCCACTTGAATACATTCAAGG + Intergenic
1066802742 10:39208491-39208513 GTGCCACCTGAAAAAGTTCCAGG - Intergenic
1073240132 10:102052087-102052109 GTGCCGTTTGAATAAGTTCAGGG - Intronic
1080567962 11:33529661-33529683 GTGACACTTGAGTACCTTCATGG + Intergenic
1093146905 12:15577470-15577492 GAGCCACTTGACCACGTTCTAGG - Intronic
1095149630 12:38777139-38777161 GTCCCACTGGAAAACCTTCAGGG - Intronic
1106175404 13:27326322-27326344 GTCCCACTGGAAGACCTTCAGGG + Intergenic
1108166360 13:47697331-47697353 GTGCCACTAGAATGAGTTTAAGG - Intergenic
1109192569 13:59343176-59343198 ATGCCACATGTAAACGTTCAGGG + Intergenic
1117211468 14:53505171-53505193 GTGCCACATGAATTAGTTAAAGG + Intergenic
1124840411 15:33236099-33236121 GTGCCACTTGAAGCTCTTCAGGG + Intergenic
1128979128 15:72174200-72174222 GTGCCACCTGAAGAAGTACAGGG + Intronic
1140643796 16:77008163-77008185 ACACCACTTGAATACCTTCAAGG - Intergenic
1142037648 16:87871576-87871598 GTGTGACTTGAACACGCTCATGG - Intergenic
1142900543 17:3008710-3008732 GCTCCACTTGAATACTTCCAGGG - Intronic
1152191529 17:78891222-78891244 GACCGACTTGAAAACGTTCATGG - Exonic
1157776553 18:50401095-50401117 GTGCCACCTGAAGACATTCCAGG + Intergenic
1162715651 19:12630659-12630681 GTCCCGCCAGAATACGTTCAGGG - Exonic
930753699 2:54955405-54955427 GGACCCCTTGAATACTTTCAAGG + Intronic
942372059 2:175295682-175295704 GTGCAGTTTGAATAAGTTCAGGG + Intergenic
942803274 2:179900547-179900569 GTCCCACTGGAAGACTTTCAGGG + Intergenic
1173061013 20:39661203-39661225 GTGCCACTCAAATACTATCAGGG - Intergenic
1174273993 20:49390299-49390321 GTCCCACATGAAAACATTCAGGG + Intronic
1183050153 22:35254398-35254420 GAAGCACTTGAATACATTCAAGG + Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
971519253 4:27528731-27528753 GTGCCACTTCAATACTGTAATGG + Intergenic
975916857 4:79335506-79335528 GTGCCACTGGAACACTTACATGG - Intergenic
980013763 4:127624266-127624288 GTGTCTCTTGAATACGTTTGTGG + Intronic
996003851 5:118397071-118397093 GAGCCACATGAAAAGGTTCATGG + Intergenic
1009566797 6:65320556-65320578 GTGCCACTTGAATACGTTCAAGG - Intronic
1013811931 6:114054560-114054582 GTGCCTCTTGAAAACATGCAAGG + Intergenic
1016211605 6:141542015-141542037 ATGCCAGTTGAATAATTTCATGG - Intergenic
1017349580 6:153424359-153424381 TTGCCACTTGGATATCTTCAGGG + Intergenic
1032720719 7:134549130-134549152 GGGCCACCTGAAGACGTTCCAGG + Exonic
1032903932 7:136342796-136342818 GTGGCCCTGGAATACGGTCATGG + Intergenic
1043153850 8:76752933-76752955 GTGCCACTTGAAAAGGTTCTGGG + Intronic
1045838249 8:106548991-106549013 ATGCCACTTTAATATATTCATGG - Intronic
1056189375 9:84169842-84169864 GTCCCACTAGAAAACCTTCAGGG + Intergenic
1187209905 X:17219190-17219212 GTGCCACTGGAAGATCTTCAGGG - Intergenic
1191803611 X:65108522-65108544 GTGCCACTAGAAGATCTTCAGGG + Intergenic