ID: 1009571427

View in Genome Browser
Species Human (GRCh38)
Location 6:65390412-65390434
Sequence TAGGGTTTTCAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 605}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009571427 Original CRISPR TAGGGTTTTCAGAAGGAGAA GGG Intronic
901467146 1:9429458-9429480 TACGGTATTCAGAAAGCGAAGGG - Intergenic
901688848 1:10959704-10959726 AAGGGCTTCCAGAAGCAGAAAGG + Intronic
903421865 1:23223573-23223595 TAGGGATTTCAAAAGGGGAGAGG + Intergenic
904495665 1:30885182-30885204 TGGGGTTTACAGAAGGAGGCTGG + Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904945039 1:34192975-34192997 GAGGATTTTCAGCAGGGGAATGG + Intronic
905114064 1:35622097-35622119 AAGGCTTTTCACAAGGGGAAAGG - Intronic
905641858 1:39595488-39595510 TTGGGTGTTCAGGAGGAGAAGGG - Intergenic
906575856 1:46888799-46888821 GTGGGTTTTCTGAAGGAGAGGGG + Intergenic
906581520 1:46939203-46939225 TATGATTATCAGAAGGAGATGGG - Intronic
906596118 1:47079095-47079117 GTGGGTTTTCTGAAGGACAAGGG - Intronic
907164573 1:52398888-52398910 TAGGGTTATTAGAAGGATTAAGG - Intronic
907580972 1:55572480-55572502 TAGAGTTTTCAGAGGGAACATGG - Intergenic
907656988 1:56353629-56353651 GAGGATTTTGAGAAGGAGGAAGG - Intergenic
908239776 1:62179028-62179050 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
908403017 1:63788565-63788587 GAGGGTTTTCTGAAGGAGGTGGG + Intronic
908608949 1:65834503-65834525 TAGAATTTTAAGAATGAGAAAGG + Intronic
909610994 1:77551721-77551743 TAGGCTTTATGGAAGGAGAAGGG - Intronic
910231814 1:84995984-84996006 AACGGTTTTCTAAAGGAGAAGGG + Intronic
910753398 1:90659149-90659171 AAGGGTTTCAAGTAGGAGAAAGG - Intergenic
912297703 1:108486430-108486452 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
912578018 1:110693486-110693508 TAGAGTCTGAAGAAGGAGAAGGG - Intergenic
915503199 1:156334496-156334518 TAGAGACTTCAGAAGGAGCATGG + Intronic
915774144 1:158464386-158464408 TATGGTTTACAGCAGGAGAGGGG + Intergenic
916042333 1:160971786-160971808 TGTGGTTTTCACAAGAAGAAAGG + Intergenic
916354891 1:163893916-163893938 CAGAGTTTTCAGGAAGAGAAAGG + Intergenic
917016756 1:170540793-170540815 TGAGGTTTTAAGGAGGAGAAAGG + Intronic
917020701 1:170583126-170583148 TGGGCTGCTCAGAAGGAGAAAGG + Intergenic
917209862 1:172620499-172620521 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
917410210 1:174751708-174751730 TATGGTTTTCAGAAAAGGAAAGG + Intronic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
917984054 1:180296783-180296805 TAGGATTTTCATAACTAGAAAGG + Intronic
917987126 1:180332127-180332149 TACAGGTTTCAGAGGGAGAATGG + Intronic
918063656 1:181084496-181084518 TAGGGTTGTCAGAAGAACAGAGG - Intergenic
918885830 1:190193117-190193139 CAGGATTTTCAGAAAGAGTAAGG - Intronic
921540759 1:216411756-216411778 TAGAGGTTTCAGAAAGAGCATGG + Intronic
921694875 1:218197399-218197421 TATGGTTTTTAGAACCAGAATGG + Intergenic
922528783 1:226327101-226327123 TGAGGTTTGCAGCAGGAGAAAGG + Intergenic
923242575 1:232099767-232099789 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
923389433 1:233499304-233499326 TAGGGTTTTCTAAGGAAGAAGGG - Intergenic
923714220 1:236411329-236411351 TATGGGTCTCAGAGGGAGAATGG - Intronic
923754576 1:236779319-236779341 TAGGAATTTTAGAAGGAGAAGGG + Intergenic
923801583 1:237214958-237214980 TATGGTATTGAGCAGGAGAAAGG + Intronic
923883424 1:238129190-238129212 TGTGGTTTGCAGCAGGAGAAAGG + Intergenic
924226331 1:241924857-241924879 TTGGATTTTCAGCAGGAGGAGGG + Intergenic
924728939 1:246694719-246694741 TAAGGGTTTCAAAAGGGGAAGGG - Intergenic
1063054353 10:2487498-2487520 TATGCTTTACAGAAGGAAAAAGG - Intergenic
1063352314 10:5366842-5366864 GAGGGTTTGCAGAGAGAGAAAGG + Intronic
1063656341 10:7993967-7993989 TAGGGTTTTGGAAAGGGGAAGGG + Intronic
1064149575 10:12851256-12851278 TAGGGACTTCAAAAGGAGAGAGG - Intergenic
1064280438 10:13946377-13946399 TAGAGACTTCAGGAGGAGAAGGG + Intronic
1064608884 10:17076170-17076192 AAGGATTTTAACAAGGAGAAAGG + Intronic
1065173112 10:23051515-23051537 AAGGGTTTTCAAAGGCAGAAAGG - Intergenic
1065609405 10:27457161-27457183 TAGTCTTTACAGAAGGAGCAGGG + Intergenic
1065846878 10:29751829-29751851 TAGGGTGATGAGAGGGAGAATGG + Intergenic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1066621315 10:37354365-37354387 TAGGGGTTTCAAAAGGGGAGGGG - Intronic
1066789028 10:39043096-39043118 TAAGGATTTCAAAAGGGGAAGGG - Intergenic
1067819758 10:49518365-49518387 AAGGGCTTGGAGAAGGAGAAGGG - Intronic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1068128233 10:52867253-52867275 TAAAGGTTTCAGAAGGAGCATGG - Intergenic
1068373709 10:56151985-56152007 TATTCTTTTCAGAAGCAGAAAGG - Intergenic
1068423340 10:56823506-56823528 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
1068537528 10:58256620-58256642 TAGGGATTTCAAAAGGGGAGGGG - Intronic
1068895186 10:62191056-62191078 TAGGGTTTTCAAATCTAGAAGGG - Intronic
1068980375 10:63056635-63056657 TTGGGTTTTTAGAAGGATATTGG - Intergenic
1069072804 10:64007035-64007057 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1069200465 10:65608718-65608740 TAGGGATTCCAAAAGGAGGAAGG + Intergenic
1069203917 10:65658251-65658273 TAAGGATTTCAAAAGGGGAAGGG - Intergenic
1070463297 10:76691337-76691359 TAAGGGTTTCAAAAGGAGAGGGG + Intergenic
1070584067 10:77747806-77747828 TAGGGTGTCCGGAAGGGGAATGG + Intergenic
1071732074 10:88258146-88258168 TAGAGTTTTGAGAAGCTGAAAGG + Intergenic
1071855540 10:89620722-89620744 TAGGGGTTTCAAAAGGGGAAGGG - Intronic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072154610 10:92713817-92713839 TAGAGCTTTCAGAGGGAGTATGG - Intergenic
1072174865 10:92910224-92910246 AATGGCTTTCAGAAGGAGAATGG + Intronic
1072403229 10:95126580-95126602 TAGGGTTTTGAGGAGGGAAAAGG + Intergenic
1073184773 10:101609274-101609296 TAAGGGGATCAGAAGGAGAAGGG + Intronic
1073482189 10:103793194-103793216 TAGGGATATCAGTAGGAGGAAGG - Intronic
1073709126 10:106018681-106018703 TAGGGTTGATATAAGGAGAAAGG + Intergenic
1074364046 10:112843990-112844012 TGGGGTGTTCAGGAGGAGGAAGG + Intergenic
1075955656 10:126520719-126520741 TAGGGCCTTCAGAGGGAGCACGG - Intronic
1076621839 10:131793991-131794013 CAGGGCTTCCAGAAGGCGAATGG - Intergenic
1077614482 11:3665303-3665325 GAGGGTTTGCAGCAGGAGATTGG + Intergenic
1078112132 11:8404109-8404131 TATGGTTTTCAGAAGAAGGAAGG + Intronic
1078464589 11:11540873-11540895 CTGGGTTGTCAGAAGGAAAATGG + Intronic
1078872780 11:15364414-15364436 TTTGGATTTGAGAAGGAGAAAGG + Intergenic
1079666879 11:23116989-23117011 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1079783341 11:24637910-24637932 TAGGGATTTTAGAAGGGGAGGGG - Intronic
1079801338 11:24873503-24873525 AAGGGTTATCTGAAGGAAAAAGG - Intronic
1080139860 11:28903823-28903845 TAGAGCCTTCAGAAGGAGAATGG - Intergenic
1080601150 11:33821456-33821478 GAGGGCTTTAAGAAGTAGAACGG - Intergenic
1080971645 11:37284637-37284659 TAAGGATTTCAGAAGGAGTTGGG - Intergenic
1081140605 11:39494193-39494215 TAGGGATTTCAAAAGGAGAGGGG - Intergenic
1081786300 11:45750223-45750245 TACAGTTTTCAGGAGGGGAAAGG + Intergenic
1082257774 11:50051423-50051445 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
1082693043 11:56328405-56328427 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1082733380 11:56827285-56827307 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1083351598 11:62033371-62033393 TGGGTTTTTGAGAAGGAGAGAGG - Intergenic
1083473839 11:62902750-62902772 TACGGGTTTCAGAAGGAGCACGG + Intergenic
1085115547 11:73928408-73928430 AAGGGTTTTAAGCAAGAGAATGG + Intergenic
1085480188 11:76815572-76815594 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1086071234 11:82802074-82802096 TAGATATTTCAGAAGGAGAAGGG - Intergenic
1086308051 11:85503528-85503550 TAGGGTTTTTAAAAGGTGATTGG + Intronic
1086323519 11:85674891-85674913 TTGGGTATTCTGAAGGAGAGAGG - Intronic
1086377827 11:86219061-86219083 AAAGGTTTTCATAAGGATAAGGG - Intergenic
1086562401 11:88183335-88183357 TAGTGTGATCAGAATGAGAAAGG - Intergenic
1087635933 11:100701285-100701307 TAGGATTTTCAGAATGGTAAAGG + Intronic
1087849013 11:103006841-103006863 AAGGCTTTTCAGTAGGGGAATGG + Intergenic
1087930664 11:103973933-103973955 AAGGGTTTTAAGCAGAAGAATGG + Intronic
1089137708 11:116263033-116263055 TAGGGCTTGCAGAAGCAGAGAGG + Intergenic
1089404345 11:118185151-118185173 TAGTGTTTTATGAAGGAAAATGG + Intergenic
1090170356 11:124596988-124597010 TAAGGATTCCAGAAAGAGAAAGG - Intergenic
1092447778 12:8573683-8573705 TAGGGGTTGCAGGAGAAGAATGG + Intergenic
1092530068 12:9336514-9336536 TAAGGATTTCAGAAGGGGAGGGG + Intergenic
1093348768 12:18071223-18071245 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1093359079 12:18201723-18201745 TAGAGTTAACATAAGGAGAAAGG - Intronic
1093837975 12:23859657-23859679 TAGGGATTTCAAAAGGGGAGGGG - Intronic
1094373951 12:29770271-29770293 TACTGTTTTTGGAAGGAGAAAGG - Intronic
1095308752 12:40669757-40669779 TGGGCTTTGCAGAAGGAGACAGG - Intergenic
1095885736 12:47186691-47186713 TACAGCTTTCAGAAGGAGCATGG + Intronic
1096838194 12:54364668-54364690 TTGGGTTTCAGGAAGGAGAAAGG - Intergenic
1096967672 12:55641388-55641410 TAGGCTTTCCACAAGGTGAAGGG - Intergenic
1097082561 12:56443625-56443647 TAGGGATTTTAGAAGGGGAGGGG - Intronic
1097494048 12:60307749-60307771 TAATATTTTCAGCAGGAGAAGGG - Intergenic
1097515718 12:60603384-60603406 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1097614498 12:61867523-61867545 TACAGTTTTCAGAAGTTGAAGGG - Intronic
1097671602 12:62546025-62546047 AAGGGTTTTCAGATGCTGAAAGG + Intronic
1097964494 12:65564464-65564486 TATGGTTTTGGGAAGGAGAGGGG - Intergenic
1098497220 12:71150439-71150461 TAAGGATTTCAAAAGGGGAAGGG - Intronic
1099009304 12:77272723-77272745 TCTGGGTTTCAGAAGGAGCAAGG + Intergenic
1099202732 12:79693963-79693985 TAGGGTTTTCAGAATGGATAAGG - Intergenic
1099513535 12:83567749-83567771 TATGGGTTTCAGAAGAAGCATGG + Intergenic
1099618585 12:84972661-84972683 TCGTGTTCTAAGAAGGAGAAAGG + Intergenic
1099664304 12:85608136-85608158 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1099915700 12:88890301-88890323 TAGTGTAGTCAGAATGAGAAAGG - Intergenic
1100078360 12:90816809-90816831 TACTGTTTTCATATGGAGAATGG - Intergenic
1100097693 12:91063084-91063106 AAGGGTTTTCAGAGAGGGAAAGG - Intergenic
1100363570 12:93899253-93899275 CAGGGTTTGCAGTGGGAGAAAGG - Intergenic
1100421073 12:94434013-94434035 TAGGGATTTCATAAGCAGAGGGG + Intronic
1100692382 12:97052198-97052220 TATAGTTTGCAAAAGGAGAAAGG - Intergenic
1100790585 12:98125957-98125979 TATAGTTTTCAGAAGGATAATGG - Intergenic
1101687996 12:107044912-107044934 TGGGAGTTTCAGAAGAAGAAGGG + Intronic
1102123766 12:110463824-110463846 GAGGGTTTTAAGAAGAGGAAAGG - Intronic
1102223016 12:111207394-111207416 TAGGCATTTCATAAGGAGGATGG - Intronic
1102531263 12:113548104-113548126 TAGGGTTTTCAAAAGGGAGAAGG - Intergenic
1102665721 12:114571136-114571158 CAAGGTTTTCAGAAGGAGCTTGG - Intergenic
1103498870 12:121384948-121384970 TAAGGGTTTCAGAATGAGGATGG + Intronic
1103845914 12:123902023-123902045 TAGAGCTTTCAGAGGGAGCATGG - Intronic
1103858855 12:123995544-123995566 CAGGCTTTGGAGAAGGAGAATGG + Intronic
1104467387 12:129001744-129001766 GAGGGTTTTAAGAGGGAGATCGG + Intergenic
1104691262 12:130828094-130828116 TAGGGTCTTCTGATGGAGATGGG - Intronic
1105604568 13:21916202-21916224 TAGGGTCTGCAGAAGTGGAAGGG + Intergenic
1105776703 13:23668938-23668960 TAAAGTTTTCAGAATGAGACTGG - Exonic
1106420012 13:29578326-29578348 TAAGGTTTGCAGTAGGACAAAGG - Intronic
1106465161 13:30006916-30006938 CAGTGCTTTCAGAAGGAGCACGG + Intergenic
1107337025 13:39366000-39366022 TAGGGTTTTCAAGGGAAGAAAGG - Intronic
1107710111 13:43142982-43143004 TAGGGCTTTCAGAGGGAGCGTGG + Intergenic
1107856975 13:44625731-44625753 TAAAGTTTCCAGAAAGAGAATGG - Intergenic
1108520868 13:51246070-51246092 TTGTGTTTTCCTAAGGAGAAGGG - Intronic
1108564277 13:51679755-51679777 TACAGCTTTCAGAAGGAGCATGG - Intronic
1108633466 13:52309781-52309803 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1108653224 13:52502756-52502778 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
1108733986 13:53263180-53263202 TAGGTTTTTAAGCAGGAGAGTGG + Intergenic
1109207789 13:59501038-59501060 AAAGGTCTTCGGAAGGAGAATGG - Intergenic
1109514693 13:63427059-63427081 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1109636889 13:65131859-65131881 TACAGGCTTCAGAAGGAGAATGG + Intergenic
1109689157 13:65863934-65863956 TACAGATTTCAGAGGGAGAATGG - Intergenic
1110476196 13:75916790-75916812 TAGAGCCTTCAGAAAGAGAAAGG + Intergenic
1110633912 13:77742944-77742966 TTGACTTGTCAGAAGGAGAAAGG - Intronic
1110934931 13:81276131-81276153 TAGGGGTTTCAAAAGGAGAGGGG - Intergenic
1111063863 13:83064034-83064056 TAGAGTTAACAGGAGGAGAATGG - Intergenic
1111257275 13:85686860-85686882 AAGGATCTTCAGAGGGAGAAAGG + Intergenic
1111566629 13:90025767-90025789 TAAGGATTCCAGAAGGAGAGAGG - Intergenic
1111717658 13:91899820-91899842 GAGGGTCTTCAGAGGGAGTATGG + Intronic
1111761578 13:92472457-92472479 TAGGCCTTTCATAAGAAGAAAGG - Intronic
1111806398 13:93044116-93044138 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1111899272 13:94181219-94181241 TAGGGATTTCAAAAGGGGAGGGG - Intronic
1111900703 13:94196326-94196348 TGTGGTTTTCAAAAGGAGGATGG - Intronic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1112397489 13:99046429-99046451 TGAGGTTTTCAAAAGGAGGAAGG + Intronic
1112786053 13:102953012-102953034 AAGGGCTTTCAGAAGGAAAGTGG + Intergenic
1113270287 13:108666029-108666051 AAGGCTTTTCAGAAGCAGGAAGG + Exonic
1113600120 13:111562666-111562688 TAGAGTCTTCAGAAGAAGAGTGG + Intergenic
1115807513 14:37068185-37068207 AAGGATTTTAAGCAGGAGAAAGG + Intronic
1116150586 14:41136559-41136581 TAGGATTTTCAGAATGGTAAGGG + Intergenic
1116349285 14:43838868-43838890 AAGCGACTTCAGAAGGAGAATGG - Intergenic
1116360843 14:43996099-43996121 TCGGGTTCACAGAGGGAGAAAGG + Intergenic
1116725949 14:48561818-48561840 TAGGGATTTCAAAACGAGAGGGG - Intergenic
1117154932 14:52929419-52929441 AAGGATTTTCAGCAGGGGAATGG - Intronic
1118203225 14:63697008-63697030 TAGGGACTTCAAAAGGAGAGAGG + Intronic
1118502301 14:66373166-66373188 TGGGTTTTTTAGAAAGAGAAGGG - Intergenic
1119101919 14:71887934-71887956 TAAGGGTTTCAAAAGGGGAAGGG - Intergenic
1120117594 14:80637944-80637966 TAGGGTTTTCAGAGGGAGTCAGG + Intronic
1120238374 14:81919152-81919174 TACAGGTTTCAGAGGGAGAATGG - Intergenic
1120430703 14:84410983-84411005 TAGGATTTTCAGAACGGCAATGG - Intergenic
1120651219 14:87135382-87135404 GATGGTTTTCAATAGGAGAATGG - Intergenic
1120713402 14:87816089-87816111 TAGGGCCTTCAGAAGGAGCTTGG - Intergenic
1121506831 14:94484080-94484102 AAGGCTTCTGAGAAGGAGAAGGG + Intergenic
1121682638 14:95806673-95806695 TAGGAATCCCAGAAGGAGAATGG - Intergenic
1122854711 14:104554542-104554564 TAGGCCTTTCAGAGGGAGGAAGG - Intronic
1123137510 14:106043084-106043106 TAGGGATTTTAAAAGGAGAGGGG - Intergenic
1124609417 15:31198132-31198154 TAGGGATAGAAGAAGGAGAAGGG - Intergenic
1125822640 15:42645848-42645870 TAGGATTTTCAGAGTGATAATGG + Intronic
1126059976 15:44771222-44771244 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
1126672270 15:51127241-51127263 TAGAGTCTTCAGAGGGAGCACGG - Intergenic
1128173970 15:65537461-65537483 TAGGATTTTCAGAATGGTAAAGG - Intronic
1128328064 15:66737903-66737925 TAGGGTTGGGAGGAGGAGAAGGG + Intronic
1129761130 15:78130000-78130022 TAGGGCTTCTAGGAGGAGAAGGG + Intronic
1130154012 15:81334083-81334105 TGGGGTCTTGACAAGGAGAAAGG - Intronic
1130302456 15:82690121-82690143 TATGGGTTTCAGAGGGAGCATGG + Intronic
1130771786 15:86931412-86931434 CAGGTTTTGCAGCAGGAGAAAGG - Intronic
1131765342 15:95669459-95669481 TAGGTTTTTAAGAAAAAGAAAGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132611828 16:820806-820828 AAGGGCTTTTAGAAGGACAATGG - Intergenic
1133151364 16:3834512-3834534 CAGGGTTTTGGGAAGGAGAGAGG + Intronic
1133411508 16:5572956-5572978 AAGGGTTTTCAGTGGAAGAATGG + Intergenic
1133451804 16:5910195-5910217 AAAGGTTCTCAGAATGAGAAGGG + Intergenic
1134262443 16:12662889-12662911 ATGGGTTTGCAGAAGGATAATGG - Exonic
1134366025 16:13579902-13579924 CAGGGTTTTCAGCTGGAAAATGG + Intergenic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1135872971 16:26169257-26169279 AAGGGTTTTCAGGAAGAGAAGGG + Intergenic
1136345980 16:29676328-29676350 TAGGGTACCCAGAAGGAAAAGGG + Intronic
1136709287 16:32222024-32222046 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136758623 16:32707395-32707417 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1136809485 16:33162984-33163006 TAGGGTCTTCAGAGGGAGTATGG - Intergenic
1136815961 16:33273064-33273086 TAGGGTCTTCAGAGGGAGTATGG - Intronic
1136851194 16:33613665-33613687 GAGCATTTTCAGAAGGGGAACGG + Intergenic
1137021416 16:35432099-35432121 TAAGGTGTTCAGAAGCATAAAGG - Intergenic
1137498066 16:48986203-48986225 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1137759572 16:50929235-50929257 TAGAGTCTTCAGACGGAGCATGG - Intergenic
1137845561 16:51684534-51684556 TGAGGTTTGCAGCAGGAGAAAGG - Intergenic
1138011490 16:53385031-53385053 TAGGGATTTGAAAAGGGGAAGGG - Intergenic
1138624920 16:58243821-58243843 AAGGGGTTTAAGAAGGAAAAAGG + Intronic
1139016084 16:62690470-62690492 TAGGGATTTCAAAAGGCGAGAGG - Intergenic
1139174786 16:64673844-64673866 TAGCACTTTCAGAAGAAGAATGG + Intergenic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1140237899 16:73175072-73175094 TGGGGTTTTCAGCAGGGAAATGG - Intergenic
1140589719 16:76337453-76337475 TAGGGATTTCAAAAGGGGAGGGG + Intronic
1140710022 16:77668993-77669015 TTTGTTGTTCAGAAGGAGAAAGG - Intergenic
1140741801 16:77948059-77948081 TTGGGTTTTAAGAGGGAGATGGG - Intronic
1140859320 16:79005498-79005520 TAGAGTTTTCAGAGAGAGGATGG - Intronic
1203060777 16_KI270728v1_random:967723-967745 TAGGGTCTTCAGAGGGAGTATGG + Intergenic
1144530732 17:16036393-16036415 TAGGATTTTCAGAATGGTAAAGG + Intronic
1144623620 17:16833404-16833426 TAGGATTTTTAGAACCAGAAGGG - Intergenic
1144644070 17:16957391-16957413 TAGAAGTTACAGAAGGAGAAGGG + Intronic
1144882809 17:18439312-18439334 TAGGATTTTTAGAACCAGAAGGG + Intergenic
1145149422 17:20505074-20505096 TAGGATTTTTAGAACCAGAAGGG - Intergenic
1145390028 17:22448446-22448468 TGAGGTTTGCAGCAGGAGAAAGG + Intergenic
1146606914 17:34268416-34268438 AAGGATTTTCTGAAGGAAAAAGG + Intergenic
1147158506 17:38557687-38557709 TAGTGTTTTCAGAAGGAAGGAGG - Intronic
1148508490 17:48147601-48147623 GAGATTTTCCAGAAGGAGAAAGG + Intronic
1150976510 17:70093301-70093323 TAGAGGCTTCAGAAGGAGCAAGG - Intronic
1151143367 17:72016493-72016515 TGGGGTCTGGAGAAGGAGAAAGG + Intergenic
1151254154 17:72862590-72862612 AAAGGTTTTGAGAAGGAGCAAGG + Intronic
1151449192 17:74187344-74187366 TGGGGTTCTCAGACAGAGAAGGG - Intergenic
1151588852 17:75029923-75029945 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1152021964 17:77784511-77784533 TGAGGTTTGCAGCAGGAGAAAGG + Intergenic
1152307300 17:79528796-79528818 TAGAGTTTTCAGAGGGAGCACGG + Intergenic
1152415258 17:80155986-80156008 TAGGGGTTTCAAAAGGGGAGGGG - Intergenic
1153003066 18:473908-473930 TAGGGCTGTGGGAAGGAGAAGGG - Intronic
1153573166 18:6494210-6494232 TGAGGTTTGCAGCAGGAGAAAGG + Intergenic
1154081736 18:11263979-11264001 TAAGGATTTCAAAAGGAGAGGGG + Intergenic
1156370225 18:36466322-36466344 TGAGGTTTGCAGCAGGAGAAGGG + Intronic
1156390646 18:36647695-36647717 AAGGGTCATCAGAAGTAGAATGG + Intronic
1156789354 18:40952933-40952955 TAGAGGGTTCAGAAGAAGAAAGG + Intergenic
1157414246 18:47488974-47488996 TAGAGTTTACAGAAGTAGCAGGG + Intergenic
1158152902 18:54392750-54392772 TCAGGTTTCCAGAAGGAGAAAGG - Intergenic
1158215451 18:55096324-55096346 TGGGGTGATCAGAGGGAGAAAGG + Intergenic
1158218976 18:55130088-55130110 TAGAGATTTCAGAAGGAGTACGG + Intergenic
1158716485 18:59884809-59884831 TAAGCTTCTCAGAAGGAGAATGG - Intergenic
1159917845 18:74202115-74202137 TAGAGTCTTCAGAGGGAGAATGG + Intergenic
1160063548 18:75553298-75553320 GCAGGTCTTCAGAAGGAGAAAGG + Intergenic
1160417520 18:78721433-78721455 TGGGGGCTTCAGAAGGGGAAGGG + Intergenic
1160956070 19:1692198-1692220 TAGTGATTTCAGAAGGAGGGGGG - Intergenic
1161747933 19:6072951-6072973 TAGGGTTTGCAGAAGGTTCAAGG + Intronic
1163962592 19:20711216-20711238 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1164237391 19:23349231-23349253 TAGGGATTTCAAAAGGGGAGGGG - Intronic
1164322948 19:24167048-24167070 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1165303726 19:34990204-34990226 CTAGGTTTTCAGAAGCAGAATGG + Intergenic
1167446213 19:49539105-49539127 CAGGGTTTCCTGGAGGAGAAAGG - Exonic
1167750234 19:51374944-51374966 GTGGGGTTTCAGAATGAGAATGG - Intergenic
1167859234 19:52269847-52269869 AAGGGTTTTAAGCAGGAAAACGG - Intronic
1168280728 19:55304128-55304150 GTGGGATTTAAGAAGGAGAAAGG + Intronic
925140248 2:1545102-1545124 GAGGATATTCAGTAGGAGAATGG - Intergenic
925456061 2:4017562-4017584 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
925519146 2:4722272-4722294 TTGGGGTTTCAGAAGGGGAGGGG - Intergenic
926586477 2:14691333-14691355 TAGGGATTTCAAAAGGAGAGGGG + Intergenic
926748793 2:16181830-16181852 AGGGGATTTCAGCAGGAGAATGG - Intergenic
928235069 2:29532091-29532113 TGAGGTGTTGAGAAGGAGAAAGG + Exonic
929745214 2:44650162-44650184 TAGGGGTTTCAGATGGAGCATGG - Intronic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
931492576 2:62765010-62765032 TAGGATTTTGAGAAGGACAATGG + Intronic
932395612 2:71445395-71445417 TAGGGATTTCAAAACGGGAAGGG - Intergenic
932507913 2:72254413-72254435 TAGAGCCTTCAGAAGGACAACGG + Intronic
933286650 2:80391534-80391556 TATGATTTTCAGAAGGATCATGG + Intronic
935122247 2:100193175-100193197 GAGGTTTTGCAGTAGGAGAAAGG + Intergenic
935558661 2:104538289-104538311 TAGGGTTTGCTGAAGCACAAAGG + Intergenic
936644433 2:114352163-114352185 AAGAGTTCTAAGAAGGAGAATGG - Intergenic
937216607 2:120317153-120317175 CCAGGTTTACAGAAGGAGAAAGG - Intergenic
937942586 2:127297461-127297483 TATGGGTGTCAGAAGGAGCATGG + Intergenic
938507467 2:131901432-131901454 TAAGGGTTTCAAAAGGAGAAGGG + Intergenic
938562583 2:132487819-132487841 TGAGAATTTCAGAAGGAGAAAGG + Intronic
938616489 2:133004515-133004537 TAGGGATTTCAAAAGGGGAGGGG + Intronic
938842580 2:135177324-135177346 TAAGGGTTTCAAAAGGAGAAGGG + Intronic
939117896 2:138081659-138081681 TGGGGTTTACAGATGGGGAAAGG + Intergenic
939306211 2:140415407-140415429 TAAGGGTTTCAAAAGGAGAGGGG - Intronic
939822048 2:146969604-146969626 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
940037302 2:149324266-149324288 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
940164766 2:150758349-150758371 CAGTTTCTTCAGAAGGAGAAAGG + Intergenic
940436601 2:153663940-153663962 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
940534808 2:154927240-154927262 AAGTGTTTCTAGAAGGAGAATGG + Intergenic
941189204 2:162355911-162355933 AAGTGTTTTCAGAAGCAGAAGGG - Intronic
941250626 2:163157124-163157146 TCGGGCTTCTAGAAGGAGAAGGG + Intergenic
941301389 2:163806989-163807011 AAGGATTTTCTGAAAGAGAATGG + Intergenic
941770529 2:169340563-169340585 GTGGGATTGCAGAAGGAGAAAGG - Intronic
942286173 2:174419231-174419253 TAGGGTTTTGAGAGAGAGGAAGG + Intronic
942582259 2:177431230-177431252 TAGGGATTTCAAAAGGGGAGGGG + Intronic
942598139 2:177612000-177612022 TGAGGTTTGCAGCAGGAGAAAGG + Intergenic
943213961 2:185006486-185006508 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
943458666 2:188141490-188141512 GAGGGGTTTTAGAAAGAGAAAGG + Intergenic
943942983 2:194022769-194022791 TAAGGTTTTCAAAAGGGGAGGGG + Intergenic
944044395 2:195392146-195392168 TAGGGTTTGTAGAGGGAGTATGG - Intergenic
944169698 2:196760961-196760983 CAAGGTTTTCAGCAGGAGAAAGG - Intronic
944509949 2:200454704-200454726 ATGTGTTTTTAGAAGGAGAAAGG + Intronic
944998035 2:205316705-205316727 TAGGTTTTTCAGGAGTAGAGAGG - Intronic
945142156 2:206698472-206698494 GAGGGTTCCCGGAAGGAGAAGGG - Intronic
945335551 2:208588619-208588641 TAGAGGTTTCAGAGGGAGCATGG + Intronic
945357244 2:208855171-208855193 TATGGATTTCAAAAGGAGAGGGG - Intergenic
946757206 2:222959718-222959740 TAGGTTTTTCAGATGCAGACTGG - Intergenic
946982761 2:225235985-225236007 TGGGGTCTTCAGAATGAGAATGG - Intergenic
947824524 2:233095799-233095821 TAGGGTTACCAATAGGAGAAGGG - Intronic
949017983 2:241724344-241724366 GAGGGTTTTGAGAAGGGGTACGG + Intronic
1168815359 20:733050-733072 TAGGGCTTTCAGAGAGAGCATGG + Intergenic
1169156350 20:3333287-3333309 TTGGATTTTCAGAAGAGGAAAGG - Intronic
1172593308 20:36132455-36132477 AAGAGTTTTGAGATGGAGAATGG - Intronic
1174727543 20:52878603-52878625 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1175009052 20:55716295-55716317 TAGAGTTTTGACAAGCAGAACGG + Intergenic
1176210218 20:63916431-63916453 TAAGGATTTCAGAAGGGGAGGGG + Intronic
1177851426 21:26353583-26353605 TTGGGTTTTTAGAATCAGAAGGG + Intergenic
1177864721 21:26499401-26499423 TAGGGATTCCAGAGGGAGTATGG + Intronic
1177984770 21:27960922-27960944 TAAGGGTTTCAAAAGGGGAAGGG - Intergenic
1178734666 21:35138067-35138089 TACAGTTTTCAGAGGGAGCATGG - Intronic
1179145804 21:38766375-38766397 TACAGTCTTCAGAAGGAGCAAGG + Intergenic
1179147281 21:38779193-38779215 TTGAGATTTCAGATGGAGAAAGG - Intergenic
1180122039 21:45759677-45759699 TTGGTTTTCCAGAAAGAGAAGGG + Intronic
1181812866 22:25414798-25414820 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1181839737 22:25646424-25646446 TTGGAGTTTCAGAAAGAGAAGGG + Intronic
1182491613 22:30676003-30676025 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1183610578 22:38901307-38901329 AAGGGATTTAAGAAGGAAAAAGG - Intergenic
1183611207 22:38907619-38907641 AAGGGGTTTAAGAAGGAAAAAGG - Intergenic
1184151637 22:42643137-42643159 TAGTGTTTCCAGAAGGGGAGGGG - Intronic
1184632694 22:45796472-45796494 TAGGGGTTTCAAAAGGGGAGGGG - Intronic
950073243 3:10169113-10169135 TAGGGATTTCAAAAGGGGAGGGG + Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951495522 3:23320984-23321006 TAAAGGTTTCTGAAGGAGAATGG - Intronic
951734611 3:25850508-25850530 TAGGATTTTCAGATGGCCAAGGG - Intergenic
951842780 3:27051996-27052018 TAGGGATTTTAGAAGGGGAGGGG - Intergenic
952688142 3:36173011-36173033 AATGATTATCAGAAGGAGAAAGG - Intergenic
953469651 3:43155813-43155835 AAGGATTTCCAGAAGAAGAAGGG - Intergenic
954854508 3:53631984-53632006 TGGGATTTTCAGAATGATAAAGG + Intronic
955412146 3:58662697-58662719 TAGGGTGGTCAGCAGAAGAAGGG - Intronic
955473229 3:59308830-59308852 GAGAGTTTTCAGAAGGATGATGG + Intergenic
957005300 3:74938756-74938778 TTAGGTTTCCAGAGGGAGAATGG + Intergenic
957184411 3:76923249-76923271 AACGGTGTTCAGAAGCAGAATGG - Intronic
957508861 3:81161121-81161143 TAGGGTTTTCAGAAAGATTATGG - Intergenic
958424421 3:93964714-93964736 TAAGGATTTCAGAAGGGGAGTGG - Intronic
958655461 3:96996783-96996805 TAGGATTTTCAGAATGTAAATGG + Intronic
958756413 3:98254629-98254651 TAAGGGTTTCAAAAGGGGAAGGG + Intergenic
958799995 3:98744184-98744206 TACAGTTTTCAGAGGGAGCATGG + Intronic
959005216 3:101012167-101012189 TAAGGGTTTCAAAAGGAGAGGGG + Intergenic
959224686 3:103564593-103564615 TAGGGATTTTAAAAGGAGAGGGG - Intergenic
959486790 3:106936024-106936046 TATGGATTTCAGAAGCTGAAAGG + Intergenic
959720531 3:109482148-109482170 TAGGGTTTATTGAAGGAGGAAGG + Intergenic
959729450 3:109584192-109584214 TAGGGATTTTAAAAGGGGAAAGG - Intergenic
959888015 3:111524951-111524973 TAAGGATTTCAAAAGGAGAGGGG - Intronic
960044182 3:113180219-113180241 TTGGGTCTTCAGAAAGTGAAAGG + Intergenic
960258905 3:115542710-115542732 TAGGGTGTTTAGAAGCAGAAAGG - Intergenic
960626240 3:119685069-119685091 TGGGGTTTTCAGAAAGGGAAGGG - Intergenic
960666785 3:120117137-120117159 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
960740702 3:120830405-120830427 GAGGGTTTTCAGTGGGAGAAGGG + Intergenic
960765670 3:121127408-121127430 TAGAGTCTTCAGAGGGAGCACGG - Intronic
961126610 3:124424299-124424321 TATGGTTTTCTGAAGAAAAAAGG - Intronic
961591481 3:127984910-127984932 AAGGGGATTCTGAAGGAGAATGG - Exonic
961919237 3:130408625-130408647 TAGGGGTTTCAAAAGGGGAGTGG - Intronic
962682554 3:137815290-137815312 TAGAGTTGTCAGGAGGAGGAGGG + Intergenic
963439253 3:145316258-145316280 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
964211497 3:154233419-154233441 CATGTTTTTTAGAAGGAGAAGGG + Intronic
964308942 3:155371588-155371610 GAGTGTATTGAGAAGGAGAAAGG + Intergenic
964617085 3:158677975-158677997 TAGGATTTTGACAATGAGAAAGG - Intronic
965044418 3:163557352-163557374 TAGTGTCTTCAGATGGAGCATGG - Intergenic
965068075 3:163878324-163878346 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
965083327 3:164064003-164064025 TAGAGGATTCAGAAGAAGAAAGG + Intergenic
965907657 3:173728813-173728835 TAGAGTCTTCAGAGGGAGTATGG + Intronic
966900872 3:184483393-184483415 TAGGGCTTCCAGAAGTAAAAGGG + Intronic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
968012346 3:195292442-195292464 TTTGCTTTTCAGAAGGAGAAAGG - Exonic
968445132 4:648604-648626 GAGGCTTTTCAGAAAGGGAATGG - Intronic
969080732 4:4616010-4616032 TGGCGTTTTAAGCAGGAGAATGG - Intergenic
969804413 4:9595582-9595604 TAAGGGTTTCAAAAGGGGAAGGG + Intergenic
969916091 4:10492936-10492958 TAAAGGTTTCAGAAGGACAAGGG - Intronic
970225158 4:13850080-13850102 CAAGGTTTGCAGCAGGAGAAAGG - Intergenic
970638873 4:18041250-18041272 TACAGGTTTCAGAGGGAGAATGG - Intergenic
970929946 4:21498019-21498041 CAGGGCTTTCTGAAGGAGTATGG - Intronic
971332237 4:25691434-25691456 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
971477184 4:27083517-27083539 TAGAGACTTCAGAAGGAGGATGG - Intergenic
971725968 4:30312470-30312492 TAAGGCTTTTTGAAGGAGAAGGG - Intergenic
972401067 4:38704385-38704407 AAGGTTTTGCAGCAGGAGAAAGG + Intergenic
972645259 4:40961989-40962011 GAGGGTCTTGAGGAGGAGAATGG - Intronic
973863782 4:55091534-55091556 TAGGGTTTTCCCAAAGAGAAAGG - Intronic
974201038 4:58640886-58640908 TCTGGATTTCAGAAGGAGAGTGG - Intergenic
974230870 4:59111994-59112016 TAGGGATTTTAAAAGGGGAAGGG - Intergenic
974297384 4:60019226-60019248 TTGCATTTTGAGAAGGAGAAAGG - Intergenic
975307661 4:72867433-72867455 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
975712072 4:77170897-77170919 TGAGGTTTGCAGCAGGAGAAAGG - Intronic
975729092 4:77320151-77320173 TAGGGTTTTCAAAAAGGGAGGGG + Intronic
976074701 4:81284593-81284615 TCGGGTTTTAATCAGGAGAATGG - Intergenic
976174737 4:82339528-82339550 TAGGGTTTTCAGAATAGAAATGG + Intergenic
976179893 4:82389143-82389165 CAGGGTTTTCAGTAGAAGATTGG - Intergenic
976448395 4:85158774-85158796 TCGGGTTGTCAAAAGGAGATTGG + Intergenic
976453275 4:85217034-85217056 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
976647731 4:87402749-87402771 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
977101153 4:92816528-92816550 AAAGGTTTCCACAAGGAGAAGGG + Intronic
978036540 4:104002210-104002232 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
978467308 4:109022101-109022123 TAGGGATTTCAAAAGGGGAGGGG - Intronic
978530268 4:109705171-109705193 TAGGATTTTCAGAATGGTAAAGG - Intergenic
978840802 4:113209549-113209571 CAAGGTTTTCAGCGGGAGAAAGG + Intronic
978995711 4:115149284-115149306 TAAGGATTTCAGAGGGAGTATGG + Intergenic
979085433 4:116404287-116404309 TAGGGAATACAGAAGGAGAGAGG + Intergenic
979162638 4:117483101-117483123 TAGAGCTTTCAGAGGGAGCATGG - Intergenic
979163645 4:117497008-117497030 TAAAGTTTTCAGAGGGAGCATGG + Intergenic
979400578 4:120244881-120244903 TAAGGGTTTCAAAAGGGGAAGGG + Intergenic
979913428 4:126400053-126400075 TAGGGTTTTAAAAGGAAGAATGG - Intergenic
979960689 4:127017717-127017739 TGGGATTTTCAGGAGGAGAGAGG - Intergenic
980013715 4:127623729-127623751 TAGCGTTTTCCGGAGGAGATGGG - Intronic
980337594 4:131496181-131496203 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
980637259 4:135523574-135523596 TAGGGGTCTCAGAATGAGATGGG + Intergenic
980862759 4:138519180-138519202 AAAGGTTTGAAGAAGGAGAAGGG + Intergenic
981141858 4:141278265-141278287 TAGAGTCTTCAGAAGGAACATGG + Intergenic
981186580 4:141810688-141810710 TCAGGTTTTGATAAGGAGAAGGG + Intergenic
981190405 4:141855894-141855916 TAGGGATTTTAGAAGGGGAAGGG - Intergenic
981312114 4:143307517-143307539 TAGAGTCTTCAGAGGAAGAATGG + Intergenic
981980188 4:150782441-150782463 TGGAGTCTCCAGAAGGAGAATGG - Intronic
982479402 4:155891002-155891024 TAGGGATTTCAAAAGGGGAAGGG + Intronic
982727486 4:158920888-158920910 TAAGGGTTTCAGAAGGGGAGGGG - Intronic
983685886 4:170408607-170408629 TAGAGGTTTCAGAAGCATAAAGG - Intergenic
983810015 4:172050196-172050218 CAAGGTTTGCAGCAGGAGAAAGG + Intronic
984938383 4:184909721-184909743 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
986447992 5:7839512-7839534 TACTGTTATCAGAATGAGAAAGG + Intronic
986534424 5:8772192-8772214 TAGGATTTTGAGGAGGAGGAAGG + Intergenic
987691063 5:21267733-21267755 GAGGTTTTTAAGAAGGAGGAGGG + Intergenic
987956494 5:24748216-24748238 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988042483 5:25907825-25907847 TAGGTTTATATGAAGGAGAAGGG + Intergenic
988173182 5:27685436-27685458 TAGAGCTTTCAGAGGGAGCATGG - Intergenic
988456867 5:31394514-31394536 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988483308 5:31647464-31647486 TAGAGCTTCCAGAAGGAGCACGG - Intronic
988663412 5:33298267-33298289 TGAGGTTTGCAGCAGGAGAAAGG - Intergenic
988723948 5:33906727-33906749 TAGGGATTTCAAAAGGGGAGAGG - Intergenic
989702131 5:44281368-44281390 TTGGGTTTTATGAAGGGGAAGGG + Intergenic
990150184 5:52809145-52809167 AATGGTTCTCAGAAGAAGAAAGG - Intronic
990151968 5:52828793-52828815 TAGAGGCTTCAGAAGGAGTATGG - Intronic
990370383 5:55112267-55112289 TATGGTTTTCATAAAGAAAAAGG - Intergenic
990529931 5:56663412-56663434 CAGGGTTTTTGGAAAGAGAAAGG - Intergenic
991419152 5:66423422-66423444 TAGGGTTTCCAGAAGAAGAAGGG + Intergenic
991972362 5:72153313-72153335 TAGAGTTTCCAGCAGGAAAATGG - Intronic
992993331 5:82307661-82307683 TAAGATCTTAAGAAGGAGAATGG + Intronic
993211107 5:84952302-84952324 CTGGCTTTTCAGAAAGAGAAAGG - Intergenic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
993583567 5:89695037-89695059 TGGGATTATCAGAAGGAAAATGG + Intergenic
994774841 5:104028129-104028151 GAGGGTTTTGGGAAGGGGAAAGG - Intergenic
995355079 5:111227965-111227987 AAGGCTTTTCTGAGGGAGAAGGG + Intronic
996146824 5:119986972-119986994 TAGGGATTTCAAAAGGTGAGGGG + Intergenic
996651439 5:125881613-125881635 GAGGGTTTTGAGGAGGATAATGG + Intergenic
997115747 5:131124131-131124153 TAAGGATTTCAAAAGGAGAGGGG - Intergenic
997133642 5:131301856-131301878 TAGGGGTATCAGAAAGGGAAGGG - Intronic
998237638 5:140412976-140412998 TACTGTTTTCAGTAGTAGAAAGG + Intronic
999325384 5:150640519-150640541 GAGGGTTTTGAGCAGGAGAGAGG + Intronic
999538159 5:152541483-152541505 GAGGGTTTTATGAAGGAGAAGGG + Intergenic
1000132368 5:158312396-158312418 TAAGATTCTCAGAAGGATAAAGG - Intergenic
1000346383 5:160317829-160317851 TAGAGTTTTCAGAGGGAGTGTGG - Intronic
1000408414 5:160913281-160913303 TGGGATTTTTAGAAGTAGAAGGG - Intergenic
1000691506 5:164327066-164327088 TAGGGATTTCAAAAGGGGACGGG + Intergenic
1001085530 5:168697670-168697692 TATGGTTTTCAGTTGTAGAAAGG - Intronic
1001692161 5:173641326-173641348 CAGGGTCCTGAGAAGGAGAAGGG - Intergenic
1002069905 5:176673002-176673024 TAGTGTTTTCAAAAGGAGAATGG - Intergenic
1002159961 5:177309228-177309250 GTGGGTTTTCAGCAGGAGATGGG + Intronic
1002823510 6:751721-751743 TAAGGTTTTCAGTAGTAGAATGG - Intergenic
1003709581 6:8574313-8574335 TAGGGGTTTCAAAAGGGGAGGGG + Intergenic
1004351947 6:14897948-14897970 TAGTGTTTCCAGAAGAAGAAAGG - Intergenic
1005882116 6:30069821-30069843 AAGGGTTAGCAGGAGGAGAAGGG - Exonic
1006972517 6:38061291-38061313 AAGGGTAATCAGAAGGAAAAAGG - Intronic
1007186318 6:39975305-39975327 TAGGGTTGTGACATGGAGAAAGG - Intergenic
1007307064 6:40915193-40915215 TAGGGTCTTCAGAGAGAGCATGG - Intergenic
1008589717 6:52981917-52981939 TGGAATTCTCAGAAGGAGAATGG + Intronic
1009516566 6:64626686-64626708 TAGAGTTTTCAGAGGGAACATGG + Intronic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1009630884 6:66198532-66198554 TAGGGATTTCAAAAGGGGAGAGG - Intergenic
1009952884 6:70416874-70416896 TAGGTTTTTCAGAAGGAATAAGG + Intronic
1010064865 6:71670590-71670612 TAGGATTTTCATAATGATAAAGG - Intergenic
1010343046 6:74779896-74779918 TATGCTTTGCAGAATGAGAAGGG + Intergenic
1010491001 6:76476570-76476592 TTGGGCTTTCAGAAGGGGTATGG - Intergenic
1010661568 6:78577428-78577450 AAGGGGTTTTAGAAGCAGAAGGG + Intergenic
1010686264 6:78858065-78858087 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1010805225 6:80227977-80227999 TAGGCTTTTCAGAATGACATTGG + Intronic
1011908465 6:92403934-92403956 TAGGATTTTCAGAATGGTAAAGG + Intergenic
1012581478 6:100875242-100875264 TAGGATTTAAAGAAGGAGAAAGG + Intronic
1012607088 6:101170839-101170861 TAAGGATTTCAAAAGGAGAGGGG + Intergenic
1013041497 6:106438439-106438461 TAGAGCCTTCAGAAGGAGCACGG - Intergenic
1013398578 6:109768923-109768945 CTGGGTTTTCAGAGGGAGCATGG - Intronic
1013560648 6:111301394-111301416 TAGGGGTTTCAAAAGGGGAGGGG - Intronic
1013637600 6:112043927-112043949 TAGGTTTTGCAGAAGGCTAAAGG - Intergenic
1013851245 6:114518801-114518823 TAGGGTTTTAACTAGGTGAAGGG - Intergenic
1014240967 6:119017087-119017109 TAGTGTTCTCAGAAAGTGAAAGG + Intronic
1014754426 6:125287834-125287856 TGAGGTTTTCAGCAGGAGAGTGG + Intronic
1014813623 6:125911588-125911610 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1015495373 6:133876444-133876466 TATGGTTTTCAGAAGTGAAAAGG + Intergenic
1015568839 6:134601370-134601392 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1016855522 6:148666585-148666607 TAGGGATTTCAGAAGCGGAGGGG - Intergenic
1016906709 6:149158269-149158291 TGAGGTTTGCAGCAGGAGAAAGG + Intergenic
1018041175 6:159923335-159923357 TAGTGCTTTCAGAATGAGCATGG + Intergenic
1018691194 6:166345460-166345482 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1018746786 6:166768525-166768547 TAGGAGTTTCAGCAGGAGACTGG + Intronic
1019140408 6:169938898-169938920 TGGGGTTTGCAGTGGGAGAAAGG + Intergenic
1019455308 7:1123729-1123751 GAGGGTTTTCAGATGGAGTGTGG - Intronic
1020508297 7:9020414-9020436 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1021782803 7:24122528-24122550 TGGGGTTTAGAGCAGGAGAAAGG - Intergenic
1022454352 7:30545553-30545575 TAGGGGTTGCAGAAGGATGAAGG - Intronic
1022499876 7:30876115-30876137 TATGGGTTTCAGAGGGAGCATGG - Intronic
1023170645 7:37387312-37387334 TAGTGCTTTCAGAGGGAGCAGGG - Intronic
1024134574 7:46393223-46393245 GTGGGTTTTCAGAAGGAGCTTGG - Intergenic
1024403277 7:48949098-48949120 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1025101098 7:56135904-56135926 GAGGTTTTGCAGCAGGAGAAAGG + Intergenic
1025722939 7:64032881-64032903 TAGGGATTTCAAAAGGGGAGGGG + Intronic
1026317767 7:69241948-69241970 GAGGTTTTGCAGCAGGAGAAAGG + Intergenic
1026318251 7:69246161-69246183 GAGGTTTTGCAGCAGGAGAAAGG - Intergenic
1026569656 7:71518165-71518187 GAGGGTTTTAAGCAGGAGCATGG + Intronic
1026666039 7:72340564-72340586 AAGGTTTTGCAGCAGGAGAAGGG - Intronic
1027216295 7:76185953-76185975 TAGGGTTTGCAGCAGGAGCTGGG - Intergenic
1027601402 7:80245520-80245542 TACGGTCTTCAGGAGGAGGAAGG - Intergenic
1027859124 7:83553053-83553075 TAAGGTTTTCAAAAGGGGAGAGG - Intronic
1027944194 7:84724115-84724137 TAGAGTTATCAGAAGCAGACAGG + Intergenic
1028017024 7:85728882-85728904 TTGGGTTTTCAGAAACAAAATGG - Intergenic
1028330404 7:89583953-89583975 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1028439157 7:90838948-90838970 TAGGGATTTCAAAAGGGGAGGGG - Intronic
1030013807 7:105198271-105198293 TGGGGTTTTCAGAGGCAGTAGGG - Intronic
1030156646 7:106462024-106462046 TGGGTTTTTAAGCAGGAGAATGG + Intergenic
1030169575 7:106588085-106588107 AAAGGTTTTTAAAAGGAGAAAGG - Intergenic
1030299166 7:107957907-107957929 AAGGGTTTTGAGAATGAGAAAGG - Intronic
1030444520 7:109632702-109632724 TACGGATTTCAAAAGGAGAGGGG + Intergenic
1031491776 7:122398443-122398465 TAGGCATTTCAGAAGGAAATGGG + Intronic
1031776889 7:125916991-125917013 AAAGCTTTTCAGTAGGAGAAAGG + Intergenic
1032018249 7:128393073-128393095 AAGGGTTTTGGGAAGGAGCAGGG - Intronic
1033086317 7:138345267-138345289 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1034407481 7:150914811-150914833 TAAATTTCTCAGAAGGAGAAGGG - Intergenic
1035342588 7:158173423-158173445 TAGGGATTTCAAAAGGGGAGGGG + Intronic
1036155114 8:6334585-6334607 TATGATTTCCAGGAGGAGAAGGG - Intergenic
1036639249 8:10572070-10572092 TAAGGGGTTGAGAAGGAGAAGGG - Intergenic
1037857003 8:22379008-22379030 TAGAGCTGTCAGAAGGAGTATGG - Intronic
1037873673 8:22525265-22525287 TAGGCATTTTAGAAGGAAAAAGG + Intronic
1038056999 8:23869009-23869031 TGGGCTTTTCAGAAGGTGGAGGG + Intergenic
1039331015 8:36536589-36536611 TAGGGATTTTAGAAGGGGAGGGG + Intergenic
1039566862 8:38558118-38558140 AAGGGGTTTCATAGGGAGAAAGG + Intergenic
1039757838 8:40542148-40542170 TAGGTTGCTGAGAAGGAGAATGG + Intronic
1040474761 8:47765987-47766009 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
1040499410 8:47993677-47993699 TAGGGATTTTAAAAGGGGAAGGG + Intergenic
1040963198 8:53057322-53057344 TAGGGTTTTCATAAAGAAAATGG + Intergenic
1041010598 8:53538875-53538897 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
1042024602 8:64409574-64409596 CATGGTTTTCAGGAGGACAAAGG + Intergenic
1042094473 8:65198265-65198287 CAGCATTATCAGAAGGAGAAAGG - Intergenic
1043212599 8:77542692-77542714 TAGGTTTTTCAGAATGCAAAAGG - Intergenic
1043347257 8:79313229-79313251 TAGAGTTTCCCAAAGGAGAAGGG + Intergenic
1043529633 8:81135203-81135225 GAGGGTTTTCTGCAGGAGAGTGG - Intergenic
1044039065 8:87342717-87342739 TAGGGATTTCAGAAGGGGAGGGG + Intronic
1044705395 8:95003696-95003718 GAATGTTTGCAGAAGGAGAAAGG - Intronic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045729298 8:105216763-105216785 TAGGGATTTCAAAAGGGGAGGGG - Intronic
1045805673 8:106158542-106158564 TAGAGATTGCAGGAGGAGAATGG - Intergenic
1046019674 8:108649708-108649730 TAGGGTTTTCAGGGAGATAAAGG - Intronic
1046670298 8:117049656-117049678 TGGTGTTTTCAGAAGGAGAAGGG - Intronic
1048253148 8:132883923-132883945 TAGAGCTTTCAGAGGGAGCACGG - Intronic
1048326856 8:133446649-133446671 TAGAGATTACAGAAGCAGAATGG + Intergenic
1048509967 8:135053484-135053506 TAGGGTCTTCATAAGGAGGCAGG + Intergenic
1048599342 8:135902462-135902484 TAGAGTCCTCAGAAGGAGCACGG - Intergenic
1049089763 8:140505775-140505797 GAGAGTTTTCAACAGGAGAACGG + Intergenic
1050277695 9:4017086-4017108 TAGTGGTTTCTGAAAGAGAAAGG - Intronic
1050340830 9:4637010-4637032 GAAGGTTTTAAGCAGGAGAAAGG - Intronic
1050986702 9:12091803-12091825 TAGGGTTTTCAGTAGGACTCTGG + Intergenic
1052041277 9:23741775-23741797 TAGGGCTTTCAAAGGGAGAAAGG - Intronic
1052041683 9:23746440-23746462 GAGCGTTTTCAGAATGAGTAAGG + Intronic
1052061126 9:23962542-23962564 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
1052125884 9:24774114-24774136 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1052528786 9:29655743-29655765 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1052643054 9:31194063-31194085 TAGGATTTCCATAAAGAGAAAGG - Intergenic
1052696065 9:31880343-31880365 TAGGGTTTTGAGAATAAAAAAGG - Intergenic
1053605638 9:39655809-39655831 AAGGGGTTTAAGAAGGAAAAAGG + Intergenic
1053863557 9:42412439-42412461 AAGGGGTTTAAGAAGGAAAAAGG + Intergenic
1054247905 9:62686606-62686628 AAGGGGTTTAAGAAGGAAAAAGG - Intergenic
1054562019 9:66721131-66721153 AAGGGGTTTAAGAAGGAAAAAGG - Intergenic
1055296752 9:74841095-74841117 AAGTGTTTTCAGAGGGATAATGG - Intronic
1055451584 9:76435848-76435870 TAGGGTTTTCACACAGTGAAGGG + Intronic
1056037470 9:82622274-82622296 TAGGGTACTAAGAATGAGAAAGG + Intergenic
1056082754 9:83113927-83113949 TAGGGATTTTAAAAGGAGAGGGG - Intergenic
1056728547 9:89143542-89143564 CAGGAGTTTCAGAAGGTGAAGGG + Intronic
1056815390 9:89797181-89797203 TATTGTTTTCAGAGGGAGACAGG + Intergenic
1056815402 9:89797272-89797294 TATTGTTTTCAGAGGGAGACAGG + Intergenic
1057169295 9:92951150-92951172 TGGGGCTTTTAGAAGGAAAATGG + Intronic
1057549372 9:96040604-96040626 AAGGGCTTTCACAAGGACAATGG + Intergenic
1057732414 9:97621912-97621934 TAGGGATTTCAAAAAGGGAAGGG - Intronic
1057805831 9:98219170-98219192 TAGGGCTGTTAGAAGGATAAAGG - Intronic
1057958287 9:99430072-99430094 TAGGGTTATATCAAGGAGAATGG + Intergenic
1058542909 9:106030615-106030637 TAAGGGTTTCAAAAGGAGAGAGG - Intergenic
1058831835 9:108824558-108824580 TAGAGGTTTCAGAAGAAGATAGG - Intergenic
1059105969 9:111511946-111511968 TAGGGATTTTAAAAGGAGAGGGG - Intergenic
1059502216 9:114764813-114764835 GAAGGTTTTAAGCAGGAGAATGG + Intergenic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1060000362 9:119952990-119953012 TAGGGTTGTCTGTAGGAGAAGGG - Intergenic
1060521724 9:124297868-124297890 TAGGGGGTTCAGATGCAGAAAGG - Intronic
1061643007 9:131974499-131974521 TAGTGTTTTCAGAGTGAGAAGGG + Intronic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1061917325 9:133762091-133762113 GATGGTTTTCAGCAGGAGACGGG - Exonic
1062728288 9:138091987-138092009 TAGGGATTTCAAAAGGGGAGAGG + Intronic
1185688026 X:1945847-1945869 TAGGGATTTCAAAAGGAGTGTGG + Intergenic
1187867728 X:23739361-23739383 TAGGATTGTCAAAAGGATAAAGG + Intronic
1188126017 X:26369989-26370011 TACAGATTTCAGAGGGAGAATGG - Intergenic
1188946007 X:36303121-36303143 TACAGGTTTCAGAAGGAGCATGG - Intronic
1189028611 X:37427147-37427169 TATGGTTTTCACAAGGCTAATGG + Intronic
1190372218 X:49753604-49753626 TAGAGATTTCAGAGGGAGCATGG + Intergenic
1191108426 X:56786990-56787012 TAGAGCATCCAGAAGGAGAACGG - Intergenic
1191147570 X:57184325-57184347 AAGGGTTTTAAAAAGGAGAGGGG - Intergenic
1191814757 X:65231186-65231208 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1191818595 X:65276231-65276253 TGGGTGTTTCAGAAAGAGAAGGG + Intergenic
1192853282 X:74980530-74980552 TCTGCTTTTCTGAAGGAGAAGGG - Intergenic
1192930743 X:75803376-75803398 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1193176617 X:78401805-78401827 TTGGGTTTCCTGAAGGAGATGGG + Intergenic
1193262451 X:79424768-79424790 TAGGGATTTTAGAAGGGGAGGGG - Intergenic
1193453416 X:81699662-81699684 GAGGGTTTTTAGAAGGTTAAAGG + Intergenic
1194305867 X:92247562-92247584 TAGAGCTTTCAGAGGGAGCACGG - Intronic
1194440814 X:93931629-93931651 TAGTGTTTCCAAAAGGGGAAAGG - Intergenic
1194527460 X:94994958-94994980 TAGGGATTTTAAAAGGGGAAGGG + Intergenic
1194769484 X:97883866-97883888 TAGGCTATTCAAAAGAAGAATGG + Intergenic
1194979757 X:100428309-100428331 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1195002266 X:100653276-100653298 TAGTGTTATCAGAAGTAGGAAGG - Intronic
1195070127 X:101270953-101270975 TAGGGTTTTAATAAGGAGATAGG - Intronic
1195389694 X:104348592-104348614 AAGGTTTTTAAGCAGGAGAATGG + Intergenic
1195938449 X:110146825-110146847 TAGGCCTTGCAGAGGGAGAATGG + Intronic
1195948814 X:110245265-110245287 AGGGGGTTACAGAAGGAGAAGGG - Intronic
1195981464 X:110582754-110582776 TAGGGATTTCAAAAGGGGAAGGG - Intergenic
1196271737 X:113720198-113720220 TAGGGATTTTAGAAGGGGAGGGG + Intergenic
1196533928 X:116818334-116818356 AAGTGTTTTCAGAGGGATAATGG + Intergenic
1197100548 X:122648717-122648739 TAATGTTTTCAAAAGCAGAAGGG - Intergenic
1197375439 X:125676773-125676795 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
1197423173 X:126263590-126263612 TAGGATTTTCAGAATGGTAAAGG + Intergenic
1197549208 X:127867321-127867343 TAGGGATTTCAAAAGGGGAGGGG - Intergenic
1197795301 X:130291681-130291703 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1198344542 X:135746803-135746825 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1198480327 X:137034344-137034366 GAGGGTTTTCAGAAGTCGAGGGG - Intergenic
1198692758 X:139302293-139302315 AAAGGTTCTCATAAGGAGAAAGG + Intergenic
1199104607 X:143849140-143849162 GAAGGTTTTCAGAAGGAGTTTGG + Intergenic
1199361470 X:146924420-146924442 TGGGGACTTCAGAAGGAGGAGGG - Intergenic
1200021258 X:153211708-153211730 TAAGGTTTTCAAAAGGGGAGGGG + Intergenic
1200770001 Y:7115782-7115804 TAGGGATTTCAAAAGGGGAGGGG + Intergenic
1201181118 Y:11346774-11346796 TTGGGTTCTCAGAAGGGGATTGG + Intergenic
1201242769 Y:11974757-11974779 TGGGATTCCCAGAAGGAGAATGG - Intergenic
1201892646 Y:18959348-18959370 TAGGGATTTCAAAAAGGGAAGGG - Intergenic