ID: 1009577058

View in Genome Browser
Species Human (GRCh38)
Location 6:65478726-65478748
Sequence CTCTTCAGTGATTCTAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 2, 1: 0, 2: 1, 3: 18, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009577058 Original CRISPR CTCTTCAGTGATTCTAAACA GGG (reversed) Intronic
902208324 1:14886103-14886125 TTTTTCAGTGATTCTTAACTGGG - Intronic
907053944 1:51347855-51347877 CTCTTCTGTCTTTTTAAACATGG + Intergenic
909462195 1:75929564-75929586 CACTACAGTGATTTTATACAAGG - Intronic
911136441 1:94445704-94445726 CTCTTCAGTGCTGTAAAACAGGG + Intronic
912096971 1:106157654-106157676 CTCTTCATTGAATCAAATCATGG - Intergenic
912568398 1:110605341-110605363 CACCCCAGTGATTCTACACAAGG + Intronic
915447079 1:155979896-155979918 CTATTTAAGGATTCTAAACAGGG - Intronic
920614910 1:207482168-207482190 TTTTTCAGTGATTTTAAATAGGG - Intronic
920911693 1:210224043-210224065 CTCTACATGCATTCTAAACATGG + Intergenic
922973122 1:229759870-229759892 CTCATCAGTCATTCTTAACTAGG - Intergenic
924657469 1:245986022-245986044 TACATCAGTGATTCTGAACAAGG + Intronic
1064117430 10:12590728-12590750 TGCTTCTGTGATTCTAATCATGG - Intronic
1066125195 10:32334894-32334916 CTTTGCAGTGGTTCTCAACAAGG - Intronic
1066233025 10:33456090-33456112 TTCTTCAGTGATTTTATCCAAGG - Intergenic
1069275934 10:66590738-66590760 CTTTTCAGTAGTTCTAAAGAGGG + Intronic
1071992078 10:91109347-91109369 CTCTTCATTGATTCTTCACTAGG + Intergenic
1072284553 10:93900961-93900983 CACTCCAGTGATTGTGAACACGG - Exonic
1073989537 10:109246659-109246681 CTCTACAGTGATTGAAAACTTGG + Intergenic
1074683249 10:115932246-115932268 CTCTCCAGTAATTCAAAACAGGG - Intronic
1075171871 10:120122901-120122923 CTCTCCAGTGATTCTGGTCAAGG + Intergenic
1075401163 10:122162795-122162817 CAGCTCTGTGATTCTAAACACGG - Intronic
1075525863 10:123186256-123186278 CTCTCCAATGAGTATAAACAAGG - Intergenic
1076638144 10:131896286-131896308 CTCTACAGTGATTTTAAAAATGG - Intergenic
1077981222 11:7302783-7302805 CTGTTTATTGTTTCTAAACATGG + Intronic
1079041560 11:17064562-17064584 CTCTTCTGTGATTCTAAGTCAGG + Intergenic
1079912267 11:26325455-26325477 CTATTCAGTGATATTAAATATGG + Intronic
1082737367 11:56871745-56871767 GTTTTCAGTGATTCTAAATTAGG - Intergenic
1083098210 11:60274929-60274951 ATCTCCAGTGATTCTACACCTGG - Intergenic
1084299705 11:68239981-68240003 CTATTCAGTCATTCAAAAGAAGG - Intergenic
1086007492 11:82055093-82055115 CTCTTGAGTGATTCTCAATGGGG - Intergenic
1086403383 11:86479469-86479491 ATGTTCAGTGATTTTAAATAAGG - Intronic
1091633067 12:2176869-2176891 TTCTTCAGTGATGGTAAAGACGG - Intronic
1091876410 12:3937553-3937575 CTCATCAGTGATTTAAAAAATGG + Intergenic
1095048702 12:37537827-37537849 CACTTCATAGATTCTAAAAAAGG + Intergenic
1095750530 12:45705599-45705621 CTCTTCACAGATTCTAAAAAAGG + Intergenic
1096822462 12:54247627-54247649 CTCATCAGTGTTACTACACATGG - Intronic
1099828553 12:87811039-87811061 CTCTCCTGTGATTCTAGAGAGGG - Intergenic
1100227670 12:92575126-92575148 CTTTGCAGTGTTTCTCAACAGGG + Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1101774026 12:107777540-107777562 TTCTTCAGTGTTTCAAAAGAGGG + Intergenic
1102782755 12:115579699-115579721 ATCTTCAATGATTCTAAAGATGG - Intergenic
1103201211 12:119089406-119089428 CTCCACAGTGATTCTGAATAAGG - Intronic
1107437147 13:40390149-40390171 CTCTTCTGTGTTGCTCAACAGGG + Intergenic
1112358795 13:98697510-98697532 CTCTGCAGTGTAACTAAACATGG - Intronic
1112776368 13:102847850-102847872 CTCTTTAGTAATTCTTCACAAGG - Intronic
1113118897 13:106905215-106905237 GCCTTCATTGATTCTAAACGAGG - Intergenic
1115808847 14:37082836-37082858 TTCTTCAGTAATACTAAAGAAGG + Intronic
1116665008 14:47763367-47763389 CTCTTCACTGATTCTTCTCATGG - Intergenic
1116867978 14:50046758-50046780 CTGTTCAGAGAATCGAAACAGGG + Intergenic
1117559862 14:56926058-56926080 CTCTTCAGTGTTTCTAATTTTGG + Intergenic
1118617176 14:67582018-67582040 CTCAGCAGGGATTCCAAACAGGG - Intronic
1118686716 14:68298774-68298796 CTCTGCAGTGATGGAAAACAAGG - Intronic
1119491426 14:75037171-75037193 CTCCTCAGTGAGTGGAAACAGGG - Intronic
1122469149 14:101954412-101954434 CTGAGCAGTGCTTCTAAACATGG + Intergenic
1125024972 15:35020626-35020648 CTCCTTTGTGATCCTAAACAGGG - Intergenic
1127807316 15:62533306-62533328 ATCTTCAGTGATTCTAAGGCAGG + Intronic
1130075882 15:80689787-80689809 CTATTCATAGATTCTTAACAGGG - Intronic
1131842952 15:96457615-96457637 CTCATCAGTGATCCTAAGAAGGG - Intergenic
1132909630 16:2302295-2302317 CTCGGCAGTGATTCTTAAAAAGG + Intronic
1133487146 16:6231339-6231361 CTCATCACTGAATTTAAACACGG - Intronic
1137418358 16:48307420-48307442 CACTTCAGTGTTTCTAAACAGGG + Intronic
1138382036 16:56609175-56609197 CTCCTCAGTGATCCTTATCAGGG + Intronic
1140811162 16:78579467-78579489 CTCTTAAGTGAATATAAACCAGG + Intronic
1144994320 17:19256675-19256697 CTCTCCTGTGGTTCTAGACAAGG - Intronic
1145777587 17:27540192-27540214 CTCATCAGTGCTTCCATACAGGG + Intronic
1146441458 17:32898933-32898955 GTTTTCAGTGACTCTAAACTGGG + Intergenic
1147701526 17:42398814-42398836 TTCAGCTGTGATTCTAAACATGG - Intergenic
1148002351 17:44397324-44397346 CTCTTCTGTGTTTCTAAGCTAGG - Intronic
1149933047 17:60774987-60775009 CTCTTAAGTCATCCAAAACAAGG - Intronic
1150411497 17:64946673-64946695 CTCTTCAGTGATTCTAAACAGGG - Intergenic
1155396166 18:25388567-25388589 CTCTCAAGACATTCTAAACAGGG + Intergenic
1156252812 18:35367642-35367664 CGATTCAGTAATTTTAAACAGGG + Exonic
1160471004 18:79133759-79133781 CTCACCAGTGCTTCTAACCAGGG + Intronic
1161873218 19:6886662-6886684 CTCTTCAGTTATTCCAACCGAGG - Intergenic
1162673177 19:12275871-12275893 CTGTTCAGTGATTTGAAATATGG - Intronic
1164441065 19:28281310-28281332 CTCATCACTTATTTTAAACATGG - Intergenic
1165374132 19:35429714-35429736 CTCTTCAGAGATACTAGACGGGG + Intergenic
928394665 2:30934319-30934341 CTCTCCAGAGACTCAAAACAGGG + Intronic
929285634 2:40132379-40132401 CTATTAAGTGATTTTAGACAGGG + Intronic
929503486 2:42510023-42510045 CTCTGCAGTGCTTTTAAACACGG - Intronic
930586782 2:53276597-53276619 CTCATCAGTGATTCTCAGCTTGG - Intergenic
931040503 2:58292972-58292994 CACTACGGTGATTCTAAACAAGG - Intergenic
931159552 2:59673717-59673739 CTCTTTAGGGATTCTCAATATGG - Intergenic
933020628 2:77186341-77186363 CTGTCCAGTGATTCTTATCAGGG + Intronic
933451575 2:82459586-82459608 CATTTCAGTGATTATAAATAAGG + Intergenic
934884657 2:98014024-98014046 CTCTCCAGAGAGTTTAAACATGG + Intergenic
935358785 2:102229890-102229912 CTGTTCCCTGTTTCTAAACAAGG - Intronic
936848123 2:116862485-116862507 CACTTCAGTGATTCTAAGAGTGG - Intergenic
941075735 2:161004419-161004441 CTCTTCAGTGATTCTCTCTAAGG + Intergenic
942017969 2:171836206-171836228 TTCTTCAGTGAATCTGAACATGG - Intronic
942911142 2:181245830-181245852 TACTTTAGTGGTTCTAAACATGG + Intergenic
948156065 2:235782722-235782744 CTATTCAGTTATTCCAAAGAAGG - Intronic
1169727691 20:8753727-8753749 CTTTTCAGTGATTGGAAACTGGG + Intronic
1169933798 20:10861627-10861649 CTCTTCAGTCGTTCCAAAGATGG + Intergenic
1172833502 20:37856832-37856854 CTCTTCAGTGGTTAAAACCAGGG + Intronic
1174590373 20:51640264-51640286 GTCTTCAGTGGTTCTCAACTGGG + Intronic
1175408192 20:58748742-58748764 GTCTTCAGTGATTCTGAAGGAGG + Intergenic
1175574128 20:60047862-60047884 TTCTGCAGAGATTCTCAACAGGG - Intergenic
1176363401 21:6017384-6017406 CTACTCAATGATTCTAAGCAAGG - Intergenic
1178268202 21:31164915-31164937 TTCTTCAGTGGTTCAAAGCATGG + Intronic
1178749049 21:35283316-35283338 CTCTTCAGTTATTTTAACCCCGG + Intronic
1179760117 21:43521161-43521183 CTACTCAATGATTCTAAGCAAGG + Intergenic
1182849811 22:33463049-33463071 ATCTACAGTCATTCTAAAGAAGG + Intronic
1184273886 22:43399595-43399617 CTCTCCTGTGATTCTGAACCCGG + Intergenic
1185362680 22:50418220-50418242 ATCTTCAGGAATTCAAAACAGGG - Intronic
952655806 3:35784036-35784058 TTCTTCAGTGATTCTAGAGTTGG + Intronic
954123911 3:48517533-48517555 CTCTTCAGTGAGAGTGAACATGG + Intergenic
954500958 3:51013696-51013718 CTCTTCAGAGCTTTTAGACAGGG + Intronic
959308227 3:104696505-104696527 CTCTTCAGTGCTGTTAGACAGGG + Intergenic
960696692 3:120403115-120403137 CCCTTCCATGATTCTAAACTGGG - Intronic
961219856 3:125191112-125191134 AACTTCAGTCATTTTAAACAGGG - Intronic
962666097 3:137654789-137654811 CTCTTCAGAGCTTCTAGGCAGGG - Intergenic
963712954 3:148768281-148768303 CTCTTCCTTGCTTCTAGACAGGG - Intergenic
963925387 3:150945246-150945268 CTCTTCTGTGCTTGTAGACATGG - Intronic
964463120 3:156958821-156958843 AACTTTAGTGATTCTCAACAAGG + Intronic
964587279 3:158320123-158320145 CTCCTGAGTGATTGTAATCAAGG - Intronic
964599327 3:158478551-158478573 CTCTACACTGATACTAAAGATGG - Intronic
965670439 3:171142363-171142385 CTCAGCAGTGATTATAAACATGG - Intronic
967709036 3:192684641-192684663 CTTTTCAGTGATTCAAAATCAGG + Intronic
971019591 4:22520315-22520337 ATGTTCAGTGATGATAAACAAGG + Intergenic
973676166 4:53265170-53265192 CTCTTCAGTGATTTTATAGAGGG + Intronic
974540558 4:63228328-63228350 CTTTTCTGTGATTGCAAACAAGG - Intergenic
979326533 4:119386193-119386215 CTCTTCAGAGATGTCAAACAGGG + Intergenic
981266689 4:142792565-142792587 CTCTAAGGTGAGTCTAAACAGGG + Intronic
981602297 4:146503866-146503888 TTCTGCAGTGATTTTAACCAAGG - Exonic
983244401 4:165270848-165270870 CTCTTCAGAGATGTCAAACAGGG + Intronic
983852348 4:172596879-172596901 CACTTGAGTAATTCTAGACAAGG + Intronic
985128866 4:186722405-186722427 GCCTTGAGTGATGCTAAACATGG - Intronic
985920676 5:2970341-2970363 CTCTTCAGATGTTCTGAACATGG + Intergenic
988480499 5:31626485-31626507 CTCTGCAGTGAGTCTAATCCAGG - Intergenic
988927519 5:36004515-36004537 CTATTCAATTATTCTAACCAAGG + Intergenic
989118649 5:37981441-37981463 ATCTACAGTGATTTGAAACATGG + Intergenic
989997788 5:50856079-50856101 CTCTGCAGTGCTTTTAAATAAGG + Intergenic
992543088 5:77783691-77783713 TTCTTCAGTGAGTATTAACAGGG - Intronic
993274306 5:85836518-85836540 TGCTTCAGTGATTCTTAACAAGG + Intergenic
993342844 5:86745986-86746008 CTCTCCAGTGGTTTCAAACATGG - Intergenic
996606953 5:125334519-125334541 CTCTGCAGTTATCCAAAACACGG + Intergenic
997172763 5:131740458-131740480 GCTTTCACTGATTCTAAACAAGG - Intronic
999561770 5:152811160-152811182 TTAGTCAGTGATTCTCAACAAGG + Intergenic
1000522089 5:162307717-162307739 TACTTCAGAGATTCTCAACAAGG - Intergenic
1001947722 5:175794397-175794419 CTCAACAGTGATTCTCAACCTGG - Intergenic
1004479776 6:16007489-16007511 CTCTTCAGTGCATATAAACTAGG + Intergenic
1004758921 6:18644301-18644323 TTCAACAGTGATTCTAAGCAAGG - Intergenic
1007842123 6:44725192-44725214 CTCTTCAGTGACTCGCATCATGG + Intergenic
1008131890 6:47728245-47728267 CTCTTCAGGGAATGTGAACAAGG + Intergenic
1009577058 6:65478726-65478748 CTCTTCAGTGATTCTAAACAGGG - Intronic
1010509024 6:76694640-76694662 CTCTTCAGTGATTCCCTACATGG + Intergenic
1010711459 6:79180139-79180161 CTCTTCTGTAATTTGAAACAGGG - Intergenic
1011814840 6:91176942-91176964 TTCTTTAGTGATTATGAACAAGG - Intergenic
1012049369 6:94320931-94320953 TTCTCCAGTGATTATAAAAAAGG - Intergenic
1012059783 6:94463541-94463563 CTCTTCAGTGCCTCTAAACCAGG + Intergenic
1012778058 6:103522487-103522509 CTCTTCAGAGATTCTAGGCAGGG - Intergenic
1015654690 6:135504386-135504408 CTGATCAGTGATTAAAAACACGG - Intergenic
1017715152 6:157205344-157205366 CTCTTTAGAGTTCCTAAACATGG + Intronic
1019010037 6:168837626-168837648 TTCTTGAGTGACTCTAGACAGGG - Intergenic
1019082903 6:169447788-169447810 CTCTTCAGGGATTCTAACTGGGG + Intergenic
1019994531 7:4715560-4715582 CTATTCATTCATTCTAAACTTGG - Intronic
1024719859 7:52123755-52123777 CACTTCAGTGATGATAAACATGG + Intergenic
1024763795 7:52631823-52631845 CTCTTCAGAGTTTCTCAAAATGG + Intergenic
1027630273 7:80595640-80595662 AGATTCAGTGATTCTTAACAAGG - Intronic
1028083569 7:86607142-86607164 CTGTTCAAAGATTCTAAACTTGG - Intergenic
1029203352 7:98853806-98853828 CTCATCAGTCAGTCTAATCAAGG - Intronic
1029930897 7:104370033-104370055 CTTTTCAGTTATTCAATACATGG - Intronic
1031149648 7:118038452-118038474 CTCTTCTGAAAATCTAAACATGG + Intergenic
1031304234 7:120104005-120104027 CTCTTTGTTGATTCTAAACTTGG + Intergenic
1031995652 7:128228859-128228881 CTCTTCTGTTATTTTCAACAGGG - Intergenic
1034094747 7:148396742-148396764 CTATTCAGAAATTCTAAAGACGG + Intronic
1036959348 8:13226890-13226912 CCCTCAAGTGGTTCTAAACATGG + Intronic
1038417342 8:27406750-27406772 CACATCAGTGAATCTCAACAGGG - Intronic
1040281245 8:46047191-46047213 CCCTTCACTGATTCTACAAAAGG - Intergenic
1044151757 8:88786467-88786489 TTCTTCAGTAAATATAAACATGG - Intergenic
1045623758 8:104016652-104016674 CTCTTCAGTGTTTTTAAAGATGG + Intronic
1046415235 8:113905273-113905295 CTGTTCATTTATTCTAAAGAAGG + Intergenic
1050673838 9:8029042-8029064 TGCTCCAGTGATTCTCAACAGGG - Intergenic
1050746315 9:8880235-8880257 TTATTCAGTGATTATAAACATGG - Intronic
1051253023 9:15181260-15181282 AACTTCTGTGATGCTAAACATGG - Intronic
1052497629 9:29247397-29247419 CTCATGAGTGATACAAAACAAGG - Intergenic
1055592098 9:77827635-77827657 CTCTTCTGTGTTTGCAAACAAGG + Intronic
1058813510 9:108663438-108663460 ATCTGCAGTAAGTCTAAACAGGG + Intergenic
1186634610 X:11389009-11389031 CTGATCAGTGATTCTCAACTGGG + Intronic
1187249273 X:17582334-17582356 CTCTTCAGTGACAAGAAACAAGG - Intronic
1189621268 X:42841259-42841281 GTGTTCAGTGATTCTCAATAAGG - Intergenic
1189877799 X:45454943-45454965 CTCTTCTGTGGTTGTAAAAATGG + Intergenic
1191227768 X:58063239-58063261 CTCTTCATTGATTCTACAAAAGG + Intergenic
1191580972 X:62760270-62760292 TTCTTCACAGATTCTAAAAAAGG + Intergenic
1194519883 X:94906040-94906062 CCATTCTGTTATTCTAAACAAGG - Intergenic
1195047618 X:101068239-101068261 CTCTTCAGTGGTTCTCAGAATGG - Intergenic
1197020540 X:121682619-121682641 CTCTTCAGTGCCTGTAACCATGG - Intergenic
1198313801 X:135446531-135446553 TTCTTCAGTGATTCCCAACATGG + Intergenic