ID: 1009582177

View in Genome Browser
Species Human (GRCh38)
Location 6:65550055-65550077
Sequence GCTCAGTGAAAAATAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009582177 Original CRISPR GCTCAGTGAAAAATAATGGA TGG (reversed) Intronic
901093635 1:6660762-6660784 GCCCAGTGAACAAGAATGAAGGG - Intronic
902707566 1:18216229-18216251 GCACAGGGAAAAATAATTGGAGG + Intronic
903379439 1:22886547-22886569 GCTAAGTGAGAAATGATGGTAGG + Intronic
904437383 1:30507549-30507571 ATTCAGTGAATAATTATGGAAGG + Intergenic
904995392 1:34627616-34627638 GCTCAGTGAAGTATAAGGCAAGG + Intergenic
906512931 1:46421613-46421635 GCTCTCTGAACAACAATGGAGGG + Intergenic
907142047 1:52196128-52196150 GCTCAATGACAAACAATGTATGG - Intronic
907365661 1:53957356-53957378 GGTCAGTGAGAAAAAATGAAAGG - Intronic
909612003 1:77561108-77561130 GCTCAGAGAAAAATAATAATGGG - Intergenic
910922910 1:92368731-92368753 GCTCAGTAATAACAAATGGAGGG + Intronic
911424708 1:97693950-97693972 GGTCAGAAAAAAATAAAGGAAGG + Intronic
911841111 1:102683317-102683339 GTTCAGTGAACTATAATGAAAGG + Intergenic
912043836 1:105427866-105427888 GGTCAGTGAAAATTGAGGGATGG + Intergenic
914200774 1:145483364-145483386 TCTCTGTGAAAAATTATGAAAGG + Intergenic
914479888 1:148056492-148056514 TCTCTGTGAAAAATTATGAAAGG + Intergenic
916424428 1:164667263-164667285 GCTAAGTAAAAAACAATGCAAGG + Intronic
916647399 1:166799237-166799259 GCACTGTGAAAATTAAAGGAGGG + Intergenic
916656137 1:166876662-166876684 GCTCGGGGAAAAATAAGGCAAGG - Intergenic
918293021 1:183127696-183127718 GCCGAGTGAAAAGTAATGGTAGG + Intronic
918901310 1:190423042-190423064 TCTCAGTAGAAAATAAGGGAGGG + Intronic
921069487 1:211647218-211647240 GCTCAGTGGAAAAGAAGAGAAGG - Intergenic
921310513 1:213838417-213838439 GCTCAGGGAAAGAAGATGGAAGG - Intergenic
922054475 1:222027432-222027454 GCTCTGAGAAAAACAATGGTTGG - Intergenic
923707522 1:236356583-236356605 GCACAGTTAAAAACAATGGTGGG + Intronic
924912149 1:248525530-248525552 GCTCAGAGAAGAAAAATGGGAGG + Intergenic
1063896301 10:10685985-10686007 CCTCAGTGAAAGATCAAGGAGGG - Intergenic
1064495690 10:15907797-15907819 GCTAAGTGAAAAATGAAGGATGG + Intergenic
1066118147 10:32258301-32258323 GCACAGTTAAAAATAAAGAAAGG - Intergenic
1068738500 10:60441891-60441913 GCTGAGTGAAAAATAACCCATGG - Intronic
1069727760 10:70592197-70592219 GATAAGTGAAAAATATTGGATGG - Intergenic
1071987915 10:91071449-91071471 GCTCACTGATAAATAAGGCATGG - Intergenic
1075493091 10:122891713-122891735 CCTAAGTGAAAAATAAGGCAAGG + Intergenic
1079641986 11:22816850-22816872 GATCAGTGAAATAGAATAGAAGG - Intronic
1081963995 11:47158419-47158441 GCTCAGTGAAAAAAAACAGCAGG - Intronic
1083239549 11:61377178-61377200 GCTCAGTGAAACAATATGGCGGG - Intergenic
1083349195 11:62015215-62015237 GTTCAGTGAAAAATTATGCCAGG - Intergenic
1083456335 11:62781371-62781393 TCTCAGTTAAAAATGTTGGATGG + Intronic
1086173817 11:83866072-83866094 GCTCTGTGAAAAAAAAAGGGGGG - Intronic
1086392409 11:86379036-86379058 GCTCAGTGGAAAATAAAGATGGG - Intronic
1086796993 11:91117759-91117781 GCGTAGTGAAAGATAATGGGAGG + Intergenic
1087042151 11:93811981-93812003 GTTCAGTGGAATAAAATGGAAGG + Exonic
1090244258 11:125204472-125204494 GCTCAGTAAAAAGTCATCGATGG + Intronic
1090694105 11:129219377-129219399 ACTCAGTAAAACAGAATGGAAGG - Intronic
1091916240 12:4273285-4273307 CTTAAGTGAAAAATAAGGGAGGG - Intergenic
1092768844 12:11878310-11878332 TCTGAGTGGAAAATAATAGAAGG + Intronic
1093191375 12:16078737-16078759 ATTCAGTGAGAAATAATGTAAGG + Intergenic
1093425697 12:19026465-19026487 GCTCGGTGAATAATAATCAAAGG - Intergenic
1094036738 12:26079997-26080019 CCTCAGTGACCATTAATGGATGG + Intergenic
1095629838 12:44362672-44362694 TTTCAATGAAAAATAATGGTTGG + Intronic
1097422728 12:59400324-59400346 GCTCTGTGTCAAATAATGGGTGG - Intergenic
1098590884 12:72210409-72210431 GCTCAGTGAAAAGGAAAGAAAGG + Intronic
1099369426 12:81811808-81811830 GCCCAGTGAGAAGGAATGGATGG - Intergenic
1099374459 12:81881945-81881967 GTTCAGTGAAAATCTATGGAAGG - Intergenic
1099865529 12:88275819-88275841 GCTCAGTAAAAAATATTTGTTGG - Intergenic
1099898167 12:88674908-88674930 GCTCAGGGAAAGATATTTGATGG + Intergenic
1100047489 12:90400214-90400236 AATCAGTGAAATACAATGGAGGG + Intergenic
1100105927 12:91171926-91171948 GCTCAATGAAAAATAAATGTAGG - Intronic
1100226000 12:92556125-92556147 TATCAATGAAAAATAATTGATGG - Intergenic
1100645374 12:96523705-96523727 GCTCAGAGAAAAAAAATGCCGGG - Intronic
1100784070 12:98060624-98060646 GTTCAGTTATAAATAATGAATGG - Intergenic
1101622862 12:106406942-106406964 GCTGACTGTAAAATAATGGAAGG + Intronic
1105799342 13:23889800-23889822 GCTCAGTTAAAAATTTTAGATGG + Intergenic
1106554890 13:30800919-30800941 GCTGATTGAAAAAAAAAGGAGGG - Intergenic
1107364398 13:39655193-39655215 GTACAGTGAAAGAAAATGGAGGG - Intergenic
1107708949 13:43133876-43133898 CCTCAGTGAAAAATGATGTTAGG + Intergenic
1108127013 13:47255651-47255673 TCCCAGTGAAATATAATGCAAGG + Intergenic
1108293348 13:48985740-48985762 GCACAGAGAAAAAGACTGGAAGG + Intronic
1108692676 13:52873479-52873501 GCACAGTGAAAAGGAATAGAGGG - Intergenic
1109377324 13:61513663-61513685 GCTAAGTGAAAACTAATTGTAGG + Intergenic
1109474442 13:62860615-62860637 TATCAGTGAAAAATAATTCATGG - Intergenic
1110123055 13:71907156-71907178 AATCAGTGAAAAATAATAGTAGG + Intergenic
1111737073 13:92155247-92155269 GCTTATTGAAAAAAAATGGAAGG - Intronic
1112539460 13:100293781-100293803 GTTCAGTAAATAATAAGGGAGGG - Intronic
1114732436 14:25007673-25007695 GCTCAGTAAACATTAGTGGAAGG + Intronic
1115929326 14:38473051-38473073 GCTCATTTAGAAATAATAGAGGG - Intergenic
1116127330 14:40804667-40804689 GTTCACTGAACAATATTGGAGGG - Intergenic
1117245455 14:53880301-53880323 GCACAGAGAACAATAAAGGAGGG + Intergenic
1117280076 14:54231283-54231305 GCTCAATGGAAAATTATGCAGGG - Intergenic
1118534122 14:66739686-66739708 GTTCAGTGGTAAATAATGTATGG - Intronic
1118771312 14:68944435-68944457 GCTCAGTAAGAATTTATGGAAGG - Intronic
1119155178 14:72403728-72403750 GTTCAATTAAAAATAATGTAAGG + Intronic
1120823500 14:88934495-88934517 GCTCACTGAAAAATCATAGAGGG - Intergenic
1122191930 14:100052046-100052068 TCTCTGTAAAAAATAACGGAAGG + Intronic
1124524150 15:30433145-30433167 GCTCAGTGAAAAATAAAATCTGG - Intergenic
1124534516 15:30533071-30533093 GCTCAGTGAAAAATAAAATCTGG + Intergenic
1124764132 15:32474528-32474550 GCTCAGTGAAAAATAAAATCTGG - Intergenic
1124774502 15:32574529-32574551 GCTCAGTGAAAAATAAAATCTGG + Intergenic
1125010290 15:34864968-34864990 GCACACTGACAAACAATGGATGG + Intronic
1125305370 15:38306357-38306379 GCTCAGAAAACAATAATGGCAGG + Intronic
1125834683 15:42738478-42738500 GCTCAGTGACAAATCAAGCAAGG + Intergenic
1126932881 15:53674539-53674561 GCTAACTAGAAAATAATGGAAGG + Intronic
1128025500 15:64433123-64433145 TCTCTGAGAAAAATAAAGGAGGG + Intronic
1129600234 15:76994522-76994544 GCTCAGTGAATGGGAATGGATGG - Intronic
1131499683 15:92950004-92950026 GCGCAGTGGAAAACAAAGGAAGG + Intronic
1131757795 15:95584586-95584608 GAGCAGTTTAAAATAATGGAAGG - Intergenic
1131987124 15:98053687-98053709 GCTGAGTGAAAAAAGCTGGAAGG - Intergenic
1132401443 15:101509621-101509643 ACACAGAGAAAAAAAATGGAAGG - Intronic
1139077143 16:63465050-63465072 GCCCAGTTTAAAATAATGGAGGG - Intergenic
1139317921 16:66089365-66089387 GCTCAGAGAAAAATAAAGCAAGG + Intergenic
1139641393 16:68294287-68294309 GCTCAGGGAAAATATATGGAGGG + Intronic
1139685709 16:68602006-68602028 GCATAGGAAAAAATAATGGAAGG + Intergenic
1141308173 16:82886895-82886917 GCTCATTGAAGAAAAATGGTTGG + Intronic
1143340794 17:6209316-6209338 TTTCATTGAAATATAATGGACGG + Intergenic
1148155583 17:45423696-45423718 GAGCAATGAAAAATAAAGGATGG - Intronic
1150387270 17:64772358-64772380 GAGCAATGAAAAATAAAGGATGG - Intergenic
1150661240 17:67081612-67081634 GCTCAGTGAAAAAGATGGCATGG - Intronic
1151063767 17:71127248-71127270 ACTGAGTGAAATATAATGCACGG + Intergenic
1152048345 17:77953632-77953654 TCTCAGTGAGAAAGGATGGATGG - Intergenic
1153022904 18:647391-647413 GCTCAGCTAAAAGAAATGGATGG + Intronic
1153049950 18:892856-892878 GTTTAATAAAAAATAATGGAAGG + Intergenic
1153922028 18:9800320-9800342 GCACGGTGGAAAAAAATGGAAGG - Intronic
1154125207 18:11686737-11686759 GATCACTGAACAACAATGGATGG - Intergenic
1155077611 18:22374356-22374378 GCTCAGTGAAAAGTAATGGCTGG + Intergenic
1156171216 18:34488612-34488634 ACTAAATGAAAAATAAAGGAGGG - Intergenic
1157772252 18:50359350-50359372 GACCAGTGAAGTATAATGGATGG + Intergenic
1158453149 18:57584839-57584861 GCTCAGTGAAAAAAAATGTTTGG + Intronic
1162416770 19:10543399-10543421 GCTCAGGGAAAAAAAATCCAGGG - Intergenic
1163180363 19:15595316-15595338 CCTGAATGAAAAATAATGCATGG - Intergenic
1164533650 19:29067343-29067365 GCACAGAGAAAAATAATTGAAGG + Intergenic
1165594513 19:37000870-37000892 GCTCTAGGAAAATTAATGGAAGG + Intergenic
1166260029 19:41632315-41632337 AATCAGTCAAAAACAATGGATGG - Intronic
927315735 2:21679127-21679149 GCTCTGTGAAAAATTTTGAAAGG + Intergenic
928446251 2:31336179-31336201 GCTCAGTGAAAATAAATGAATGG - Intronic
928632690 2:33210061-33210083 ACTCAGTGAAAAGCAATGTAAGG - Intronic
928633276 2:33216012-33216034 GCTATGTGAAAACCAATGGAGGG - Intronic
929683500 2:44014576-44014598 GCTGAGTGAAAAATACTGTGAGG - Intergenic
930838525 2:55820884-55820906 GACCAGTGAAATAGAATGGAGGG + Intergenic
930880961 2:56269746-56269768 GCTCACTTAAAAAAAATGAAAGG - Intronic
933894166 2:86795236-86795258 GCTCAGTAAAAGCTAAAGGAAGG + Intronic
935131322 2:100263233-100263255 GCTCTGTGCAAGATAATGGGGGG + Intergenic
939312300 2:140497322-140497344 ACTCAGTGAGATATAATGAAGGG - Intronic
940566469 2:155368364-155368386 GATCAGTAAAAAATAATCCAAGG + Intergenic
940747101 2:157579981-157580003 GCTAAATGAAAAAGAATGAAAGG - Intronic
942404207 2:175635953-175635975 GCACAGTGGAAAATGATGGTTGG - Intergenic
942915751 2:181304426-181304448 GGTCAGTCAAAAATAAAGAAAGG - Intergenic
944317955 2:198303533-198303555 GCTCAGTGAATCATAATGTTAGG - Intronic
944596203 2:201263632-201263654 CCTCAGAAAAAAATAATTGAGGG + Intronic
945018254 2:205543081-205543103 GCTCAGTAAATATTAATGAACGG + Intronic
946708699 2:222485140-222485162 GCGCAGTGGAAAAGAATGGATGG - Intronic
947096400 2:226572168-226572190 GCACAGTGAAAAATAAAGTGGGG - Intergenic
1169718953 20:8651108-8651130 ACTCAGATAAAAATAATGAAAGG - Intronic
1170519017 20:17163770-17163792 GCTCAGTTGAAAAGACTGGAAGG - Intergenic
1171527065 20:25822186-25822208 GCTCAGTTTGAAATAATGAAAGG + Intronic
1173872804 20:46352352-46352374 GCCCAGAGAAAAAGCATGGAAGG + Intronic
1174910199 20:54599958-54599980 CCACAGTGAAAAATAAAGTAGGG + Intronic
1175616108 20:60399625-60399647 GAACAGGGAAAAATAATGTATGG - Intergenic
1175635009 20:60574593-60574615 CATCAGTGAAACAGAATGGAGGG + Intergenic
1177792209 21:25734081-25734103 AATCAGTGAAAAAAAATGAAAGG - Intronic
1178150914 21:29792679-29792701 GCTCAGTGCAACATGATGCATGG + Intronic
1178170013 21:30030151-30030173 GGTCAGTGAAGAAGAATAGAAGG + Intergenic
1181754754 22:25015964-25015986 GCTCAATAAAAAATAGTTGAGGG - Intronic
1184950340 22:47837446-47837468 GCACAGTGGAAAATAAGGCAGGG - Intergenic
950789706 3:15462371-15462393 GCTCTTTGGAAAATATTGGAGGG - Intronic
950930517 3:16784335-16784357 GCACATTGAAAAATAAAGAAGGG + Intergenic
951950112 3:28190769-28190791 GCTCAGTGAATGATAGTTGAAGG - Intergenic
952749113 3:36810620-36810642 GCTCAATGAAAAATAATAAGAGG + Intergenic
953194147 3:40716060-40716082 GCTCACTGAGATATCATGGAGGG + Intergenic
955161869 3:56471325-56471347 GCTCAGTTTGAAATACTGGAAGG - Intergenic
956352420 3:68352319-68352341 CCTCAGTGAAAGGTAATTGAAGG + Intronic
957680216 3:83424271-83424293 GCTCAGGTAAAAATATTAGAAGG - Intergenic
958503437 3:94943750-94943772 GCTCAATAAAAAATGATAGAGGG - Intergenic
959100228 3:102001679-102001701 GGTCAGTGAAATAAAAGGGAAGG + Intergenic
960814653 3:121660239-121660261 TCCCAGTGGAAAATAATGAAGGG + Intronic
960891863 3:122457561-122457583 GGACAGTGAAAAATAATGAGTGG - Intronic
961372873 3:126441910-126441932 ACTCAGAGAAAAATAAAAGAAGG - Exonic
961838384 3:129684523-129684545 CCTCACTGAAAAATACTAGATGG + Intronic
964732895 3:159885977-159885999 GGTAAGTGAAAAATAATTTAAGG - Intronic
964926086 3:161959802-161959824 GCCCATTGAAAAATTTTGGAAGG - Intergenic
965293777 3:166917291-166917313 GCTTGGTGAAAAGTAATGGGTGG - Intergenic
965806490 3:172547508-172547530 TCTCAGTGAAGAGTAATGAAAGG + Intergenic
965810303 3:172584850-172584872 TCCCAGTGTAAAATAATGGAGGG - Intergenic
966636109 3:182135492-182135514 ACTCAGTGAAAAACAAAGCAGGG - Intergenic
967056348 3:185832457-185832479 GCTAAGTGAAAAGTTATAGAAGG + Intergenic
967456845 3:189697382-189697404 GATCAATGAAACAGAATGGAAGG - Intronic
968015286 3:195325972-195325994 GCTCAAAGAAAAATAATTAAAGG - Intronic
968869725 4:3235604-3235626 GCACAGTGGTAAATGATGGAGGG - Exonic
969854649 4:9989455-9989477 TCTCAGTGAAAAAGAAAGCATGG - Intronic
970166389 4:13242692-13242714 GCTTGGTGCAAGATAATGGAGGG - Intergenic
972976420 4:44641841-44641863 GCTAAGTGAACAATAATAGCAGG - Intronic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
976668864 4:87629545-87629567 GCTAAGAAAAAAATAATGTAGGG + Intergenic
977227094 4:94405379-94405401 GGTCTGTGAAAAATATTTGAAGG - Intergenic
978378215 4:108097864-108097886 GGTCAGTGGAAAATAATGGAAGG + Intronic
978467756 4:109027637-109027659 TCTAAGTGAAAGATAAAGGATGG + Intronic
979980218 4:127246007-127246029 GCTAAGTGAAAAGACATGGAGGG - Intergenic
980113177 4:128654081-128654103 GCTCAGTAAATATTAATTGAAGG + Intergenic
980963900 4:139502320-139502342 GCATGGTGAAAAATAAAGGAGGG + Intronic
982211419 4:153039579-153039601 GCAAAGTGAAAAACAATGCATGG - Intergenic
982337627 4:154257925-154257947 GCTCAGTGTGAAATAAGTGAAGG - Intronic
982562046 4:156941224-156941246 GGTAAGTGAAACATAATGAAGGG + Intronic
982651374 4:158091524-158091546 GGAAAATGAAAAATAATGGAAGG + Intergenic
983527690 4:168777051-168777073 GGTCATTGAAAAATCAAGGATGG + Intronic
984389701 4:179113133-179113155 GCACAGGGAAAAATAACGTATGG + Intergenic
985121332 4:186645664-186645686 GCACAGTGGATAAAAATGGATGG + Intronic
986444967 5:7813277-7813299 GCTCAGTGAATATTTATGGAAGG + Intronic
986723262 5:10575694-10575716 GCTGATTTAAAAATAAAGGAAGG + Intronic
986764784 5:10915548-10915570 GCTCAGTTAAAATAAATGGAAGG - Intergenic
990063370 5:51680605-51680627 TCTCAGTGAAAAATGGTGAAAGG + Intergenic
993318945 5:86447934-86447956 GATCATTGAAAAAAATTGGAAGG + Intergenic
994978481 5:106842024-106842046 ACACAGTAAAAAATAATGAAAGG + Intergenic
995056489 5:107765130-107765152 CCTGAGAGAAAAATAAAGGAGGG + Intergenic
995333642 5:110974580-110974602 GAGCAGAGAAAAATATTGGATGG + Intergenic
996060970 5:119033019-119033041 ACTCAGTCTAAAATAATGGGGGG - Intergenic
996131893 5:119791503-119791525 GCTCAGAGAAAAAGGAGGGAAGG + Intergenic
998002141 5:138633721-138633743 CCTCAGAGAAAAACAAAGGATGG - Intronic
998403908 5:141863031-141863053 GCTGAGTGAAGATTAAGGGAGGG - Intronic
999576304 5:152981863-152981885 TCTCAGTGAAAAATAGCTGAAGG - Intergenic
999754585 5:154654715-154654737 GTTAAGTGAAAAATAAAGGCAGG - Intergenic
1000117119 5:158163926-158163948 ACCCAGTGAAAAAAAATGTAGGG + Intergenic
1000695964 5:164384339-164384361 GCTCAGTGAGAAACAAAGAATGG - Intergenic
1000756395 5:165166121-165166143 GATCAGAGAAATATAGTGGAGGG + Intergenic
1001117152 5:168949233-168949255 GCTCAGTGACACTTACTGGAAGG - Intronic
1001263233 5:170251168-170251190 GTTCAGTAATAAATAATGGGTGG + Intronic
1003129475 6:3383188-3383210 GCTGAGTGAAAGATAACGTATGG + Intronic
1004135393 6:12961166-12961188 GCAGAGTGAAAAATAGTGTAGGG + Intronic
1005079642 6:21944249-21944271 GCTCAGTGAATAACAGTGGTGGG + Intergenic
1006457073 6:34138041-34138063 ACTCAATGAAAAATAATTGGGGG - Intronic
1006632160 6:35437297-35437319 GCTCAGGTAAGAATGATGGAAGG - Intergenic
1008247283 6:49193148-49193170 CCCCATTTAAAAATAATGGAAGG - Intergenic
1008453797 6:51684897-51684919 ACTTAGTGAATCATAATGGATGG - Intronic
1009582177 6:65550055-65550077 GCTCAGTGAAAAATAATGGATGG - Intronic
1010990854 6:82478514-82478536 GCTCATTGAAACATACTGGCAGG - Intergenic
1012072111 6:94635826-94635848 GATCACTCAAAACTAATGGAAGG - Intergenic
1015194707 6:130512552-130512574 ACTCAGGGAACAATCATGGAAGG + Intergenic
1015265060 6:131283131-131283153 GATCAGTGAAAAATATTATAAGG - Exonic
1015462594 6:133509881-133509903 TCAGAGTGAAAAATAATTGAAGG + Intronic
1015512281 6:134049779-134049801 GCACAGTGAAAAATTTTGGTAGG - Intronic
1015858400 6:137650008-137650030 ACTCAGTAACAAAGAATGGAAGG + Intergenic
1018219156 6:161561373-161561395 CCTCAGTGAAATATAAAGTATGG - Intronic
1018541908 6:164890207-164890229 GCCAAGTGAAACATATTGGATGG - Intergenic
1020959942 7:14789423-14789445 ATTCAGTGATAAAAAATGGATGG - Intronic
1024136049 7:46410009-46410031 ACTCAATAAAAAATAAAGGATGG - Intergenic
1026298152 7:69074049-69074071 GCTGAGAGTAAAAGAATGGAGGG - Intergenic
1030237823 7:107285977-107285999 GCTAAGAGAAAAATAAAGCAAGG + Intronic
1030369930 7:108687293-108687315 GCTCAGGGTAAAAGACTGGAGGG + Intergenic
1030717336 7:112824810-112824832 TATCAGTGAAATATAATAGATGG - Intronic
1031224951 7:119024456-119024478 GTTCAGTGAAGAATGATTGAAGG - Intergenic
1031582496 7:123493491-123493513 CCTCAGTCAAAAATAAGGCAGGG + Intronic
1031982004 7:128134109-128134131 CCTCAGTGAAAAAGGAAGGAAGG + Intergenic
1037017738 8:13929386-13929408 GCTCTGAGAAAAATAAGGGGAGG + Intergenic
1038957178 8:32480395-32480417 CCACAGTTAAAAATAATGTATGG + Intronic
1041159827 8:55028326-55028348 GCTCAGTGGAATATAATGGCTGG - Intergenic
1041926922 8:63246944-63246966 GTTCTGTGAAGAATAATGGTGGG + Intergenic
1042967281 8:74368157-74368179 GCTTAGTGAAACATAATGAAAGG + Intronic
1044451068 8:92336129-92336151 ACTCAGTGAGAAGGAATGGATGG + Intergenic
1044786984 8:95805031-95805053 GCCCAGTGCAAAATAATGTAGGG - Intergenic
1044936961 8:97302646-97302668 CATCAGTGAAAAAGAATGAATGG - Intergenic
1045177567 8:99742117-99742139 ACTCAATGAAAAATGATGAAGGG + Intronic
1045920930 8:107528276-107528298 GATCAGTGACAAAAAATGAAAGG + Intergenic
1046378603 8:113421695-113421717 GCTTGGTGAAAAATAGAGGATGG - Intronic
1048095965 8:131294588-131294610 ACTCAGTGAATATTTATGGAAGG + Intergenic
1048254444 8:132895117-132895139 GGTCAGTGAGAAATCTTGGAAGG - Intronic
1048563903 8:135573391-135573413 GTTTAGTGAAAGATAAGGGAAGG - Intronic
1049424304 8:142531287-142531309 GCTCTGTGAATATTGATGGAGGG + Intronic
1050873515 9:10606338-10606360 ACTCAGTGGAAAAGGATGGAGGG - Intronic
1052453610 9:28664847-28664869 GCTCAGTTAAAAGTAAAGCAAGG - Intronic
1052647792 9:31259616-31259638 TCCCACTGAAAAATAATGAAAGG - Intergenic
1059013482 9:110488469-110488491 GGTTAGGTAAAAATAATGGAGGG + Intronic
1060678555 9:125539847-125539869 GGTCAGTAAAAAAAAATGAAAGG + Intronic
1060723249 9:125992006-125992028 GCTCAGTGAAGAGAAATGAATGG + Intergenic
1061056818 9:128227302-128227324 GCTCAGTAAAAAAGAATGCGCGG - Intronic
1061519435 9:131109248-131109270 GCTCAGTAATGAAGAATGGAAGG + Intronic
1186326701 X:8485620-8485642 TGTCAGTAACAAATAATGGATGG + Intergenic
1187617945 X:21018594-21018616 TCTAAGTGAAAAATAACGCAAGG - Intergenic
1188039230 X:25352553-25352575 GCACAGTGATAAATAAGGCAGGG + Intergenic
1188269758 X:28124372-28124394 GCACAGTAAAAAATAAGGAATGG - Intergenic
1190030924 X:46972119-46972141 AATCATTGAAAAATAATGAAAGG + Intronic
1190170991 X:48111463-48111485 GCTGAGTGAAAAAAAATTGCAGG + Intergenic
1191112703 X:56819967-56819989 TCTAAGTTAAAAATAATGGCTGG + Intergenic
1191852620 X:65596853-65596875 GCTCAGTGATTAATAAATGAGGG - Intronic
1192098133 X:68234892-68234914 TCTATGTGAAAAATATTGGAGGG - Intronic
1192571003 X:72204635-72204657 TCTCAGTGAAACAAAGTGGATGG + Intronic
1192751640 X:73998299-73998321 CCTCAGTGAGCAAAAATGGAAGG + Intergenic
1192792584 X:74397779-74397801 TCTCAGTGAGAAATATTAGATGG - Intergenic
1193220507 X:78920345-78920367 GGTAATTGACAAATAATGGAAGG + Intergenic
1193608461 X:83597730-83597752 GCTCAGATAAAAATGATGGCTGG + Intergenic
1194456746 X:94114074-94114096 GCACAGTGAAAAACAATAGCAGG - Intergenic
1195363963 X:104110092-104110114 GCTCAGACAAAAATAATGACAGG - Intronic
1195901426 X:109801764-109801786 GCTCAGTTAAAGATCCTGGAGGG + Intergenic
1196380403 X:115083292-115083314 GCGCAATAAAAAATAATGAAGGG - Intergenic
1196396369 X:115266545-115266567 GCTCATTGAAATATAATGGTGGG + Intergenic
1197289317 X:124636354-124636376 GCAGATTGAAAAATAAGGGAAGG - Intronic
1199515517 X:148670768-148670790 GCACACTGAAAAAGAATGGATGG - Intronic
1199742293 X:150747029-150747051 ACTAAGGGAAAAATAATTGAGGG + Intronic
1201691555 Y:16771656-16771678 GATAAGTGATAGATAATGGATGG - Intergenic
1202064707 Y:20926007-20926029 TCTCAGTTAAAAAAAATGAAAGG - Intergenic