ID: 1009584080

View in Genome Browser
Species Human (GRCh38)
Location 6:65574042-65574064
Sequence AGGGACTCCCACTGCCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009584080 Original CRISPR AGGGACTCCCACTGCCATGT TGG (reversed) Intronic
900352550 1:2242458-2242480 AGGGACACCCACTCCCCTGCGGG - Intronic
901963391 1:12845495-12845517 AGGGACCCTCAGTGCAATGTTGG - Intergenic
903338919 1:22642341-22642363 AGGGACTCCTAGGGCCAAGTGGG + Intergenic
904055500 1:27667383-27667405 AAGGTCTCACACTGCCAGGTTGG - Intronic
904118878 1:28182565-28182587 AGGGTCTCACTCTGCCATGTAGG - Intronic
904164964 1:28548408-28548430 AAGGCTTCCAACTGCCATGTTGG + Intergenic
904577046 1:31511564-31511586 AGGAACTTCCCCTGACATGTGGG + Intergenic
906702473 1:47869938-47869960 AGGGGCTCCCACTTTCTTGTTGG - Intronic
906735982 1:48128657-48128679 TGGGACTGCCACTGCCCAGTTGG - Intergenic
910939972 1:92522781-92522803 AGGGTCTCCCACTGTCACCTAGG + Intronic
912070803 1:105806953-105806975 AGGGGATCCCACTGCCCTGAAGG + Intergenic
914740242 1:150458426-150458448 AGGGTCTCCCTCTGTCATCTAGG - Intronic
915341327 1:155178451-155178473 AGGGTCAGGCACTGCCATGTGGG - Intronic
915693619 1:157716230-157716252 AGAGAAGCCCACTGCCATGAAGG - Intergenic
916046780 1:161005804-161005826 AGAGACTTCCACAGCCATGGTGG - Intronic
916785264 1:168082519-168082541 TGGGACTCCCAATGCCTTCTGGG + Exonic
919147197 1:193651016-193651038 AGAGAAGCCCACTGCCATGAAGG - Intergenic
919780723 1:201219010-201219032 AGGGTCTCCCTCTGTCATGCAGG - Intronic
921310082 1:213833818-213833840 AGGGTGGCCCACTACCATGTGGG + Intergenic
922685297 1:227634129-227634151 AGGGAAACCCACTGCCTTGAAGG + Intronic
923432159 1:233933372-233933394 AGGGTCTCCCTCTGCCATCCTGG + Intronic
923440981 1:234020085-234020107 AGGGCATCCCAAAGCCATGTGGG + Intronic
924382160 1:243474969-243474991 AGGGTACCCCATTGCCATGTGGG + Intronic
1063068460 10:2634602-2634624 AGTGACTGCCACTTCTATGTGGG + Intergenic
1063922901 10:10949398-10949420 TGGGACACCCAGTGCCATGGTGG + Intergenic
1068367447 10:56068795-56068817 AGGGATTCACACTACCATCTGGG + Intergenic
1068422139 10:56808086-56808108 AGGGACCCCAACAGCCAAGTTGG + Intergenic
1069918026 10:71799079-71799101 AGAGGCTCCCACTGCCATTTTGG - Intronic
1070193193 10:74131571-74131593 AGGGTCTCCCTCTGCCATCCAGG + Intronic
1070915048 10:80148205-80148227 AGGGGCGCCCACTGCCCTGGAGG + Intergenic
1071100454 10:82030711-82030733 AGGGACCTCCACTGTCAAGTTGG + Intronic
1071950341 10:90696850-90696872 AGGGCCTCCCACTGCCTCTTTGG + Intergenic
1075315391 10:121449003-121449025 AGGGACACCCACTCTCATGGTGG + Intergenic
1075946597 10:126438836-126438858 CGGCACTCCCACTGCCATGTTGG - Intronic
1076906749 10:133366363-133366385 CGGTCCTCCCACTGCCCTGTTGG - Intronic
1076911080 10:133389978-133390000 AGGGGCTCCACCTGCCATTTTGG - Intronic
1077019271 11:410332-410354 AGTGAGGCCAACTGCCATGTCGG - Intronic
1077309129 11:1880769-1880791 AGGGGCTCCCCCTGCCACATGGG + Intronic
1077792042 11:5451546-5451568 AGGGACAGCCACTGCCTTGCTGG + Intronic
1078832660 11:14992155-14992177 ATGTACACCCACTGCCATATTGG - Intronic
1080973162 11:37303173-37303195 ATGGACTCACAGTTCCATGTGGG + Intergenic
1081948550 11:47021511-47021533 AAGGACTCCCCCTGCCAGGCAGG - Intronic
1083306619 11:61765047-61765069 GGAGACTCCCACAGCCCTGTGGG + Intronic
1083411021 11:62492425-62492447 AGGGAATCCCATGGCCAGGTGGG - Intronic
1083893985 11:65611205-65611227 AAGGACTCCCCCTCCCAAGTGGG - Intronic
1084945909 11:72638330-72638352 AGTGACTGGAACTGCCATGTAGG - Intronic
1087043571 11:93825191-93825213 AGGGTCTCCCTCTGCCACCTAGG + Intronic
1087281837 11:96219649-96219671 AGGGTCTCACTCTGTCATGTAGG + Intronic
1088199898 11:107320995-107321017 AGGCACCCCCACTTGCATGTTGG + Intergenic
1088411488 11:109539459-109539481 AGGGAAACCCACTGCCATGAAGG - Intergenic
1089526364 11:119099753-119099775 AGGGTCTCCCTCTGTCATGCAGG - Intronic
1089812851 11:121145828-121145850 AGGGACACCTTCTGCCAGGTGGG + Exonic
1090602085 11:128383448-128383470 AGGGGATACCACTGGCATGTAGG + Intergenic
1091198268 11:133750262-133750284 AGGGCCTCCCACTGCCCAGCTGG - Intergenic
1091311320 11:134577105-134577127 AGGGACTCACCGAGCCATGTGGG - Intergenic
1092435183 12:8441754-8441776 ATGGACACCCACTGCTTTGTTGG - Intergenic
1092985559 12:13842104-13842126 AGGGACTGCCACTGCCAGTATGG + Intronic
1094551093 12:31452317-31452339 TGGTACTCTCACTGCAATGTAGG + Exonic
1098742044 12:74184982-74185004 AGGAACTCCCACTACCAGGTTGG - Intergenic
1098972025 12:76867116-76867138 AGGGTGTCTCACTGTCATGTAGG + Intronic
1099099816 12:78424718-78424740 AGGGTCTCACTCTGCCATCTAGG - Intergenic
1099181017 12:79472820-79472842 GTGTACTCCCACTGCAATGTTGG - Intergenic
1100399304 12:94214108-94214130 AGGGTCTCCCTCTGTCATCTAGG + Intronic
1100775711 12:97971479-97971501 ATGGATCCCCACTGCAATGTAGG - Intergenic
1101607509 12:106258789-106258811 AGGGGATCCCACTGCCCTGAAGG + Intronic
1103088122 12:118077718-118077740 AGGGAAGCCATCTGCCATGTTGG + Intronic
1103266318 12:119633559-119633581 AGGGTCTCACTCTGTCATGTAGG - Intronic
1104604335 12:130176966-130176988 GGGCACTCCCTCTGCCATGCTGG + Intergenic
1105460334 13:20579535-20579557 AGGGACACCCACTGCCTTGAAGG - Intronic
1107582303 13:41803444-41803466 ATGGACTCACAGTTCCATGTGGG + Intronic
1108036134 13:46292569-46292591 AGGGTCTCCCTCTGTCATGTAGG - Intergenic
1112658092 13:101474209-101474231 AGGGAAGCCCACTGCCCTGAAGG + Intronic
1112685318 13:101818378-101818400 AGGTCCTCCCTGTGCCATGTAGG + Intronic
1114317761 14:21523753-21523775 AGGGCCTCTCACCTCCATGTTGG + Exonic
1117706772 14:58478036-58478058 AGGGTCTCCCTCTGTCATCTAGG + Intronic
1118473359 14:66094731-66094753 AGGGCCTGCCACTGCCATCAAGG + Intergenic
1122270017 14:100564826-100564848 TGGGGCTCCCACTGACATCTGGG - Intronic
1123128945 14:105970187-105970209 AGGAACTGCCATTGCCATATAGG - Intergenic
1123409461 15:20046352-20046374 AGGAACTGCCATTGCCATATAGG - Intergenic
1123518792 15:21053060-21053082 AGGAACTGCCATTGCCATATAGG - Intergenic
1125272310 15:37952817-37952839 AGGGGATCCCACTGCCCTGAAGG + Intronic
1126674615 15:51149197-51149219 AGGCCCCACCACTGCCATGTTGG - Intergenic
1127996201 15:64154293-64154315 AGGGGCTCCTACTCCCAAGTGGG + Intronic
1128186163 15:65645001-65645023 TGGGACAGCCACTGCCATGTGGG + Intronic
1130251796 15:82304635-82304657 CGGGCCTCCCACTGCCCTGCTGG + Intergenic
1130633891 15:85598181-85598203 TTGGACTCCCCCTGCCATGCTGG + Intronic
1132551063 16:553978-554000 AGGGACCCCGCCTGCCCTGTGGG - Exonic
1132556021 16:573032-573054 AGGGAGTCCTCCTGCCCTGTGGG + Intronic
1133376486 16:5291582-5291604 AATGACTCCCACTGCTCTGTGGG - Intergenic
1136184740 16:28580706-28580728 AGGGTGTCACACTGTCATGTAGG + Intronic
1136871340 16:33810684-33810706 AGGAACTGCCATTGCCATATAGG + Intergenic
1137635569 16:49983445-49983467 AGGGTCTCCCACTGTCATGCAGG - Intergenic
1203100832 16_KI270728v1_random:1305374-1305396 AGGAACTGCCATTGCCATATAGG - Intergenic
1145011926 17:19373149-19373171 AGGGATGCCCACTGCCGTGATGG + Intronic
1146260771 17:31418878-31418900 TGTGACTCCCACTGCCATCAGGG + Intronic
1146978887 17:37141067-37141089 AGGGACTACAATGGCCATGTTGG - Intronic
1147217216 17:38907946-38907968 AGTGACTCCCAAGGTCATGTAGG + Intronic
1147813511 17:43191226-43191248 AGGGTCTCACTCTGTCATGTAGG - Intronic
1148430113 17:47635805-47635827 AGGGTCTCCCACTGTCATGTAGG + Intergenic
1148753030 17:49956788-49956810 AGGGAGTCTCTCTGCTATGTGGG - Intergenic
1149568171 17:57653861-57653883 ATGGACTCCCAGAGCCAGGTGGG + Intronic
1151540051 17:74760200-74760222 CGGCACTCCCACAGCCCTGTGGG - Intronic
1152291991 17:79445283-79445305 AGGGGGTCCCACTGCCCAGTGGG + Intronic
1152573304 17:81129794-81129816 AGGGACCCCCACAGCCATCCGGG + Intronic
1156339626 18:36199794-36199816 AGCGACTCCCACTGCTCTCTGGG - Exonic
1157862467 18:51153641-51153663 AGCCACTCCCAATGCCCTGTGGG + Intergenic
1158119214 18:54029836-54029858 AAGGACTCCCACTGTCTTGGGGG + Intergenic
1158830880 18:61277341-61277363 ACATACTCCCTCTGCCATGTTGG - Intergenic
1160304553 18:77719668-77719690 ATGTTCTTCCACTGCCATGTTGG + Intergenic
1160819427 19:1051105-1051127 TGGGACTCTGCCTGCCATGTGGG + Intronic
1161742629 19:6032623-6032645 GGGGGCTCCCCCTGCCAAGTGGG - Intronic
1162015518 19:7844712-7844734 AGGAACTCTCATTGCCAAGTGGG - Intronic
1163832824 19:19555160-19555182 AGGGACTCCCAGTGGCCCGTGGG - Intergenic
1164491101 19:28714933-28714955 AGGGAAGCCCACTGCCCTGAAGG + Intergenic
1165571976 19:36782976-36782998 AGGGTCTCACTCTGTCATGTAGG - Intergenic
1166144702 19:40826087-40826109 AGGGATTACCTCTGCCATCTTGG + Intronic
1166183041 19:41122120-41122142 AGGGATTACCTCTGCCATCTTGG - Exonic
1166636740 19:44457654-44457676 AGTGACTCCCGCTGAAATGTGGG + Intergenic
1166758592 19:45210837-45210859 AGCCACTGCCACTGCCCTGTAGG - Intronic
1168275756 19:55277457-55277479 GGGGACTCCACCTGCCATGAGGG + Intronic
926115437 2:10210167-10210189 ATGGACTCCCACCTCCTTGTGGG + Intronic
926219231 2:10924146-10924168 AGGGACCCTCATCGCCATGTTGG - Intergenic
926358620 2:12064398-12064420 AGGAACTCCCAGTGCAATGTAGG - Intergenic
928828905 2:35455264-35455286 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
929937909 2:46307989-46308011 GTGAACTCCCACTGCCATGGTGG - Intronic
930059744 2:47278040-47278062 AGGGAGTCCAACTTCCCTGTTGG - Intergenic
931001039 2:57782318-57782340 AGGGTCTCCCTCTGCCACCTGGG - Intergenic
931792541 2:65677567-65677589 TGGGACTCCCACTGGCATAATGG - Intergenic
935587212 2:104812125-104812147 AGGGACTCCCTCTGTCACCTAGG - Intergenic
937259799 2:120578142-120578164 AGGCTCTCCCCCTGCCATGCAGG - Intergenic
938673946 2:133611709-133611731 AGGGACTTCCAATGGCCTGTGGG - Intergenic
938938692 2:136149653-136149675 AGGGACTCAGACTGCTATGAGGG + Intergenic
939189725 2:138902136-138902158 AGGGGCTCCCACAGCCATAGAGG + Intergenic
940468691 2:154064990-154065012 AGGGGAGCCCACTGCCATGAAGG + Intronic
941768171 2:169321807-169321829 AGGGACTATCACTGCCACTTGGG - Intronic
943831779 2:192472803-192472825 AAGGAAGCCCACTGCCCTGTAGG + Intergenic
944130274 2:196340248-196340270 AGGGACTCACAATGGAATGTTGG - Intronic
945264529 2:207877959-207877981 AGGGACTCCCTCTGTCATCCAGG + Intronic
1168917204 20:1499989-1500011 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
1169241264 20:3982865-3982887 AGGGTCTCACTCTGTCATGTAGG - Intronic
1169257552 20:4110689-4110711 AGGGACTCGCTCTGGCATGTGGG + Intergenic
1172314640 20:33944150-33944172 TGGGACTGGCAGTGCCATGTGGG + Intergenic
1173185269 20:40835775-40835797 AGGGTCTCCCTCTGCCTGGTTGG - Intergenic
1175833400 20:61979189-61979211 AGCCACTGCCACTGCCGTGTGGG - Intronic
1177590481 21:23159146-23159168 AGGGACTCCCACTGCTTTGCTGG + Intergenic
1177771335 21:25519476-25519498 AGAGAAACCCACTGCCATGAAGG + Intergenic
1177858722 21:26427934-26427956 AGGGTCTCACTCTGCCATCTAGG - Intergenic
1178199063 21:30381626-30381648 ATGGACTCCCAGTTCCAAGTGGG - Intronic
951218130 3:20042923-20042945 AGGGTCTCACTCTGCCACGTAGG + Intronic
952946486 3:38481164-38481186 AGGGATTCTCACACCCATGTCGG + Intronic
954884231 3:53857866-53857888 AGGGACCACAACTGCCACGTCGG - Intronic
955181053 3:56670380-56670402 AGGGTCTCCCTCTGCCCTCTAGG + Intronic
956088286 3:65636986-65637008 AAGGAGTGCCACTGCCATCTTGG + Intronic
958682791 3:97353048-97353070 AAGGAATCCCACTGCCTTGAAGG + Intronic
963179452 3:142338712-142338734 AGGGAACCCCACTGCCCTGAAGG + Intronic
963634519 3:147777305-147777327 ATGGACTCACAGTTCCATGTGGG - Intergenic
964225975 3:154402388-154402410 AGGGTCTCACTCTGCCATCTAGG - Intronic
964876528 3:161373388-161373410 GGGGACTACCAAGGCCATGTTGG + Intergenic
964952746 3:162316957-162316979 AGGGAGTTCCACTGCCATGAAGG - Intergenic
967863906 3:194174924-194174946 AGGGACTCACTCTGCCATCCAGG + Intergenic
969598340 4:8161429-8161451 AGGGGCTCCTGCTTCCATGTTGG - Intergenic
973374988 4:49280349-49280371 ACGGACTCCCACTGAAGTGTGGG + Intergenic
973375887 4:49286371-49286393 ACGGACTCCCACTGAAGTGTGGG + Intergenic
973381525 4:49323870-49323892 ACGGACTCCCACTGAAGTGTGGG - Intergenic
973382423 4:49329892-49329914 ACGGACTCCCACTGAAGTGTGGG - Intergenic
975313109 4:72925373-72925395 AGGGGAGCCCACTGCCATGAAGG - Intergenic
976541447 4:86281668-86281690 AGGAAATCCCACTGGAATGTTGG + Intronic
976732507 4:88278409-88278431 CTGGACTCCCACTACCATCTGGG + Exonic
978478646 4:109162488-109162510 AGGGAGTCACACTGCTATGTAGG - Intronic
978934577 4:114359380-114359402 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
979525540 4:121712244-121712266 AGGGACTCTCTCTGTGATGTAGG - Intergenic
979594970 4:122525079-122525101 AGGGGATCCCACTGCCCTGAAGG - Intergenic
981866479 4:149426237-149426259 AGGAACTCCCACTGACTGGTTGG - Intergenic
986808601 5:11332310-11332332 AGTGCCTCCCACTACCATGTAGG - Intronic
986826873 5:11531648-11531670 AGGGAGAGCCACTGCCATGGCGG + Intronic
986890222 5:12294802-12294824 AGAGACCCCCACTGCATTGTGGG + Intergenic
988173067 5:27683863-27683885 ATGGACTCACAGTTCCATGTGGG + Intergenic
992098576 5:73383542-73383564 AGGCCCTCCCACTGTCCTGTGGG + Intergenic
992525580 5:77606775-77606797 AGGGTCTCACTCTTCCATGTAGG - Intronic
992910197 5:81388976-81388998 ACGGACTCACAGTTCCATGTGGG - Intronic
993448075 5:88039498-88039520 TGGGACTTCCAGTACCATGTTGG + Intergenic
994217831 5:97158999-97159021 AGGGGATCCCACTGCCCTGAAGG - Intronic
995371874 5:111427509-111427531 AGGGGAGCCCACTGCCATGAAGG + Intronic
997371139 5:133361276-133361298 AGGGTCTCCCACTCCCAGGATGG - Intronic
997887309 5:137641708-137641730 AGGCTCACCCACTGCCATGTGGG + Intronic
998075619 5:139233789-139233811 AGAGTCTCCCTCTGCCACGTAGG - Intronic
999189519 5:149736478-149736500 AGGCACTCCGACTACCTTGTAGG - Intronic
1000651305 5:163822021-163822043 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
1002267721 5:178046766-178046788 AGGGACCCCCAGTGACATCTGGG + Intronic
1004358943 6:14954044-14954066 GGGGATCCCCACTGCGATGTGGG + Intergenic
1006848256 6:37078181-37078203 AAGGATTCCCACTGGAATGTGGG + Intergenic
1007361243 6:41358054-41358076 AGGCACTCCCACTCCCACGCTGG + Intergenic
1007662419 6:43495050-43495072 GAGGACTCCCAATCCCATGTGGG - Intronic
1009584080 6:65574042-65574064 AGGGACTCCCACTGCCATGTTGG - Intronic
1012945659 6:105463201-105463223 AGGGTCTCACTCTGCCATTTGGG + Intergenic
1013845672 6:114447942-114447964 AGGTTCTGCCCCTGCCATGTGGG + Intergenic
1014053987 6:116991535-116991557 AGGGAATCTCGCTGCAATGTTGG + Intergenic
1014431757 6:121379474-121379496 AGGGTCTCACTCTGCCATCTAGG + Intergenic
1018211692 6:161488513-161488535 AGGGTCTTCCTCTGCCACGTAGG + Intronic
1019039064 6:169087904-169087926 AGGAATTCCCACTGGAATGTTGG + Intergenic
1019061629 6:169261476-169261498 AGGGACTCCCACTGTAACGGGGG + Intergenic
1020306656 7:6841000-6841022 GGGGACTCCCCCTGCGATATTGG - Intergenic
1022216950 7:28272674-28272696 AGGGACCCCCTTTGCCATCTGGG - Intergenic
1022374149 7:29797743-29797765 AAGGACTGTCACTGCAATGTAGG - Intergenic
1022762076 7:33365741-33365763 AGGAACCCCCACTGCTGTGTTGG + Intronic
1023306003 7:38827592-38827614 GGGGCCTCCCACTGCCAAGATGG + Intronic
1024661243 7:51497335-51497357 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
1025034957 7:55588209-55588231 AGGGGCTGCCACTGCCAGTTTGG - Intergenic
1026167432 7:67922712-67922734 AGGGTCTCCCTCTGCCACCTAGG - Intergenic
1026629648 7:72027295-72027317 AGGTACTCCCTCTGGAATGTCGG + Intronic
1028207473 7:88033627-88033649 GGGGAATCCCATTGCCCTGTAGG - Intronic
1030059816 7:105613376-105613398 AGGCGCTCCCACTCCCAGGTGGG + Intronic
1034527660 7:151675823-151675845 AGAGCCTCCCTCTGCCATGGCGG - Intronic
1035305847 7:157930746-157930768 TGGCACGCCCACTCCCATGTTGG - Intronic
1035409757 7:158629998-158630020 TGGAGCTCTCACTGCCATGTTGG - Intergenic
1038419418 8:27422827-27422849 AGGCCCTCACACTTCCATGTTGG + Intronic
1042178719 8:66062982-66063004 AGGGTCTCACTCTGCCACGTAGG - Intronic
1042297966 8:67242777-67242799 AGGGAAGCCCACTGCCCTGAAGG + Intronic
1045586217 8:103540065-103540087 AGGCAACCCCACTGCCATATTGG - Intronic
1045880173 8:107029259-107029281 AGTTATCCCCACTGCCATGTTGG - Intergenic
1047700749 8:127447211-127447233 TGGAACTCCCACTGGCATGGTGG - Intergenic
1048822155 8:138390451-138390473 ATGGACTCACAGTTCCATGTGGG - Intronic
1051703981 9:19856939-19856961 AGAGACCACCACCGCCATGTGGG + Intergenic
1052063332 9:23987226-23987248 AGGGAAGCCCACTGCCCTGAAGG + Intergenic
1052471584 9:28903499-28903521 AGGGTCTCCCTCTGTCACGTAGG + Intergenic
1052860410 9:33434740-33434762 GGGGATCCCCACTTCCATGTTGG - Intergenic
1052937616 9:34106116-34106138 AGGGTCACCCTCTGTCATGTAGG + Intronic
1053204462 9:36174319-36174341 AGGGAAGCCCACTGCCCTGAAGG + Intergenic
1053216694 9:36277424-36277446 AGGGACTCTCACAGCCAGATTGG + Intronic
1053404601 9:37861295-37861317 AGCGAATCCCATAGCCATGTGGG - Exonic
1057856603 9:98605575-98605597 AGGGACTGCTGCTGCCATTTGGG + Intronic
1058968321 9:110057406-110057428 AGAGACTCGCTCTGCCATGCTGG + Intronic
1060393048 9:123294409-123294431 AGGGTCTCACTCTGTCATGTAGG + Intergenic
1061104803 9:128521506-128521528 AGGGTCTCACCCTGTCATGTAGG - Intronic
1061506429 9:131034262-131034284 AGGGACTGCCCCTGCCTTGGAGG - Intronic
1062101517 9:134731006-134731028 AGGAACTGTCAGTGCCATGTTGG - Intronic
1062335018 9:136061199-136061221 GGGGTCTCCCACTGCCTGGTCGG + Intronic
1062598976 9:137311664-137311686 AGGGCCTCCCAGGGCCTTGTGGG - Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1186940899 X:14506424-14506446 TTGGACTCCCTTTGCCATGTTGG + Intergenic
1188616027 X:32160257-32160279 AGGGTCTCACTCTGTCATGTGGG + Intronic
1189265849 X:39715669-39715691 GTGGACTCCCACTGAGATGTGGG - Intergenic
1189522488 X:41784498-41784520 AAGGACTAGCATTGCCATGTAGG + Intronic
1189883585 X:45516512-45516534 GAGGAAACCCACTGCCATGTAGG + Intergenic
1193167850 X:78302298-78302320 AGGGGAGCCCACTGCCATGCAGG - Intronic
1193802479 X:85952823-85952845 AGGGGAGCCCACTGCCATGAAGG + Intronic
1193815758 X:86102767-86102789 AGGGAAGCCCACTGCCCTGAAGG + Intergenic
1193873379 X:86829841-86829863 AGGGACACACACTGACATTTGGG - Intronic
1194065303 X:89253507-89253529 AGGGGATCCCACTGCCCTGGAGG + Intergenic
1195971494 X:110478170-110478192 AGGGGATCCCACTGCCCTGAAGG - Intergenic
1196232446 X:113239912-113239934 AGGGAAGCCCACTGCCCTGAAGG - Intergenic
1198086218 X:133285203-133285225 GTGGACTTCCACTGCCATTTCGG - Intergenic
1198967032 X:142237982-142238004 ATGGACTCACAGTTCCATGTGGG - Intergenic
1199676832 X:150196344-150196366 AAGGCCTCCCAGTGCCATCTGGG + Intergenic
1200008588 X:153104593-153104615 ATGGACTCACAGTTCCATGTAGG - Intergenic
1200719473 Y:6587591-6587613 AGGGGATCCCACTGCCCTGGAGG + Intergenic
1200824364 Y:7622655-7622677 AGGGACTCCCACAGTGAAGTGGG + Intergenic
1201609300 Y:15823143-15823165 TGGTACTCCCACTCCCATGAGGG - Intergenic
1202235691 Y:22708432-22708454 AGGGACTCCCACAGTGAAGTGGG - Intergenic
1202307468 Y:23487736-23487758 AGGGACTCCCACAGTGAAGTGGG + Intergenic
1202563333 Y:26182850-26182872 AGGGACTCCCACAGTGAAGTGGG - Intergenic