ID: 1009584360

View in Genome Browser
Species Human (GRCh38)
Location 6:65578911-65578933
Sequence CTGTGTGACCATAAGAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009584360 Original CRISPR CTGTGTGACCATAAGAGAAT GGG (reversed) Intronic
903725271 1:25437914-25437936 CTGTGTCAAAAAAAGAGAATTGG + Intronic
908144026 1:61218765-61218787 CTCAGTGACCATCACAGAATTGG - Intronic
910326360 1:86012647-86012669 CTGTGTGAACATAAGACTGTGGG - Intronic
913319707 1:117579561-117579583 CTGTGGGATCAGAAGAGACTTGG + Intergenic
923418293 1:233787082-233787104 GTGTGTGTACATAAGGGAATAGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1065267004 10:23987017-23987039 CTCTGTGATCATGAAAGAATGGG - Intronic
1066593260 10:37019363-37019385 CTGTGTGGCCATAAAAGAGATGG + Intergenic
1067361589 10:45585610-45585632 CTCTGGGAACATAACAGAATGGG + Intronic
1067770947 10:49124756-49124778 CTGTGTGACAATTAGAACATAGG + Intergenic
1068353572 10:55881369-55881391 CTGTGTGTCCCTAGGACAATGGG - Intergenic
1070395965 10:76011470-76011492 GTGTGTGACCATGAGCGAGTGGG + Intronic
1070695976 10:78563346-78563368 CTGTGTGACCTTAGGAGCAGGGG + Intergenic
1072779563 10:98237949-98237971 CTGTGTGACCTTGAGAGGGTAGG + Intronic
1078499569 11:11857337-11857359 CTTTGTGATAACAAGAGAATTGG + Intronic
1080000286 11:27340114-27340136 TTGTGTGAACAAAACAGAATGGG + Intronic
1082873209 11:57962552-57962574 CTGTGTGATCAGAAGAAAATTGG - Intergenic
1085770959 11:79325504-79325526 CTGTGTGAGCATGTGAGCATGGG + Intronic
1085895043 11:80628977-80628999 CTCTGTGACCATAAGAGAGATGG - Intergenic
1091191676 11:133701013-133701035 CTGGGTGACCCTCAGAGTATTGG + Intergenic
1093219113 12:16398206-16398228 CTCTGTGACTTTAAGAGAAGTGG - Intronic
1093914424 12:24785404-24785426 CTGTGTGAACATAATATTATGGG + Intergenic
1102187075 12:110957317-110957339 CTGCGTGACCTTGAGTGAATTGG + Intergenic
1106494012 13:30258095-30258117 CTGTTTGACCATTAGAGCAGAGG - Intronic
1107187460 13:37540895-37540917 CTGTGAGATCAGAAGAGGATGGG + Intergenic
1110101321 13:71608789-71608811 CTCTGTGCCAATAGGAGAATAGG + Intronic
1110689799 13:78419589-78419611 CTGTGTGACCATAAGGGCATTGG - Intergenic
1113777735 13:112958373-112958395 CTGCATGGCCTTAAGAGAATAGG - Intronic
1113865483 13:113519678-113519700 CTGTGTGACCAACACAGACTTGG - Intronic
1119163674 14:72474630-72474652 CTGTGTGAACACAACAGAAATGG + Exonic
1123667123 15:22616881-22616903 CTGGGTGGCAATGAGAGAATGGG - Intergenic
1124320964 15:28711448-28711470 CTGGGTGGCAATGAGAGAATGGG - Intronic
1124487987 15:30136003-30136025 CTGGGTGGCAATGAGAGAATGGG + Intronic
1124522061 15:30413287-30413309 CTGGGTGGCAATGAGAGAATGGG - Intronic
1124536604 15:30552931-30552953 CTGGGTGGCAATGAGAGAATGGG + Intronic
1124543076 15:30604980-30605002 CTGGGTGGCAATGAGAGAATGGG + Intronic
1124755540 15:32402318-32402340 CTGGGTGGCAATGAGAGAATGGG - Intronic
1124762049 15:32454661-32454683 CTGGGTGGCAATGAGAGAATGGG - Intronic
1124776581 15:32594407-32594429 CTGGGTGGCAATGAGAGAATGGG + Intronic
1124942731 15:34233188-34233210 CTGTGTTACAATGACAGAATGGG + Intronic
1125065430 15:35479199-35479221 CTGTGTGACCAGAGGAAAACTGG + Intronic
1126634835 15:50770200-50770222 TTCTTTGACCACAAGAGAATTGG + Intergenic
1132334941 15:101042343-101042365 CTGTCTGCCCAGAAGACAATGGG - Intronic
1135245045 16:20848459-20848481 CTATGTGACCCTAGGAAAATTGG - Intronic
1136543433 16:30942005-30942027 CTGTGTGGCCAGAAGAGAGCTGG + Intronic
1137829119 16:51526953-51526975 TTGTGTGGCTATAAAAGAATTGG - Intergenic
1139541057 16:67616782-67616804 CTTTGTGACCAGTGGAGAATTGG + Exonic
1140921938 16:79546767-79546789 ATGTGTGACCCAAAGAGAAAAGG + Intergenic
1140947353 16:79781905-79781927 CTCTGAGTCTATAAGAGAATTGG + Intergenic
1141027880 16:80564992-80565014 CCGTGTGACCCTAAGAGCAGAGG - Intergenic
1143098564 17:4491833-4491855 CTGTGTGACCATATCAGTTTGGG + Intergenic
1143302048 17:5917731-5917753 GTGTGTGACCCCAAGAGAAGAGG + Intronic
1203167082 17_GL000205v2_random:107272-107294 CTGTGTGCACATAAAAGAAAGGG - Intergenic
1156361453 18:36387873-36387895 CTGTGTGACCATTACAGGAAGGG + Intronic
1158325349 18:56307902-56307924 CTGTGAAACCATAAAAGAATCGG + Intergenic
1158959669 18:62579095-62579117 CTGCGTGACCACTAGAGAAAGGG + Intronic
1162136390 19:8557910-8557932 ATGTGTGACCACAAGAGAAGAGG - Intronic
1165206394 19:34191919-34191941 CTGTTTGGCCATCAGAGAAAGGG + Intronic
1165651981 19:37499429-37499451 CTCTGTGACTATAAAAGATTAGG + Intergenic
1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG + Intergenic
925844170 2:8020591-8020613 CTGTGGGACCAGAGGAGAACTGG + Intergenic
928438310 2:31270415-31270437 CTGAATGACCTGAAGAGAATAGG + Intergenic
929169362 2:38916079-38916101 ATATGTGACCATATGAGCATGGG + Intronic
932701263 2:73993475-73993497 CTCTATGACCAGAAGGGAATGGG + Intronic
933215991 2:79630372-79630394 GTGGGAGACCATCAGAGAATTGG + Intronic
934053334 2:88228763-88228785 CTCTGTGACTATAAGAAAACTGG - Intergenic
935388248 2:102523751-102523773 GTCTGTTACCATAAAAGAATGGG - Intronic
936522813 2:113222222-113222244 CTGTGTGGCCAGTAGAGAATCGG - Intronic
940763881 2:157768826-157768848 CACCATGACCATAAGAGAATAGG - Intronic
941545070 2:166839893-166839915 CTTTTTGACCATTAGATAATAGG + Intergenic
942498944 2:176568029-176568051 CTGTGTGAATATAAGCAAATTGG + Intergenic
942980830 2:182079530-182079552 CTGTCTGACCTTGAGAGAGTGGG + Intronic
944626632 2:201576328-201576350 CTCTGTGACTATAAAAGATTAGG + Intronic
945403912 2:209423178-209423200 CTTTTTAAGCATAAGAGAATTGG + Intergenic
947102823 2:226639419-226639441 CTGTGTGACCATATGTGTCTGGG - Intergenic
1171441188 20:25164553-25164575 CCTTGTGACCACAAGAGAAAAGG - Intergenic
1175452259 20:59079463-59079485 CTGTGTGACCATCATAGTGTTGG - Intergenic
1176404677 21:6351827-6351849 CTGTGTGCACATAAAAGAAAGGG + Intergenic
1176432480 21:6637277-6637299 CTGTGTGCACATAAAAGAAAGGG - Intergenic
1177378787 21:20310276-20310298 CTGAGTTACCATAAGTGACTTGG + Intergenic
1180885010 22:19236341-19236363 CTGTGAGTTCATAAGAGAAGGGG + Intronic
949095988 3:86315-86337 ATGTGTGACTAGATGAGAATAGG + Intergenic
949290665 3:2461844-2461866 CTGTGTGACCCTAAGCAACTTGG - Intronic
950950837 3:16996548-16996570 CAGTGGGACCATAAGGGAAATGG + Intronic
951738025 3:25889218-25889240 CTTTGTGACCAGAAGACAAAGGG + Intergenic
952407214 3:33015354-33015376 CTGTGATACCTTAAGAGGATAGG + Intronic
954533786 3:51342966-51342988 CTGTGTGAGCCTAAGACAGTGGG - Intronic
955122824 3:56078410-56078432 CTGGCTGACCATAACAGAACAGG + Intronic
957176709 3:76820228-76820250 CTGTGTGGCAATAAAAGAAAGGG - Intronic
958778906 3:98518372-98518394 CTGCCTGACCATCAGGGAATAGG + Intronic
959575967 3:107934394-107934416 CTGTCTGCCCATCAGAGGATAGG - Intergenic
961243675 3:125433707-125433729 CTGTGTGACCCAGAGAGCATGGG + Intergenic
961633715 3:128319819-128319841 CTGTGTGCCCAGAACATAATAGG + Intronic
962538103 3:136349818-136349840 CTGTATGCCCTTAAGAGAATTGG - Intronic
967608033 3:191471276-191471298 CTGTGTACCCATAAGGGGATTGG + Intergenic
968542447 4:1174932-1174954 CCGTGTGCCCATCAGAGCATGGG + Intronic
970500514 4:16672207-16672229 CTGTGTGACCTTCAGTGAGTTGG - Intronic
975190933 4:71461355-71461377 CTGAGTGACAATAACAGAAGGGG - Intronic
977412572 4:96686873-96686895 CTGTTTGAACACAAAAGAATTGG + Intergenic
978362576 4:107946940-107946962 CTGTGTGACCAAGAGAGTAAGGG - Intronic
980642799 4:135601571-135601593 TCTTGGGACCATAAGAGAATAGG + Intergenic
983358672 4:166699489-166699511 CTGTGTGAACAGAAGAGAAGAGG + Intergenic
984161337 4:176255911-176255933 CTGTGTGATAATACCAGAATAGG - Intronic
984465182 4:180090899-180090921 CTATGTGACCATAAGACTACTGG + Intergenic
985248476 4:187999631-187999653 CTGTGTGAACAGAACAGAAGAGG + Exonic
986723012 5:10573493-10573515 ATGTATGTCCATAAAAGAATTGG - Intronic
988992769 5:36687702-36687724 GTTTGTGTCCATAAGAGAAATGG + Exonic
989264612 5:39458538-39458560 CTGTGTCACCATATGAGAAGGGG - Intronic
989267842 5:39498169-39498191 CTGGGTAAACAAAAGAGAATTGG + Intergenic
989295387 5:39819454-39819476 TTGTGTGTCCATAAAATAATGGG + Intergenic
992354317 5:75965178-75965200 ATTTGTGACCATAAGAGATTGGG + Intergenic
992556117 5:77905438-77905460 CTGTGTGGCCATACGAAAAAAGG + Intergenic
993538686 5:89120922-89120944 CAGTGTGGCAATAAGGGAATTGG + Intergenic
995628825 5:114110601-114110623 TGGTGTGTCCAAAAGAGAATGGG - Intergenic
995901099 5:117067204-117067226 CTCTGTTACCATGAAAGAATGGG - Intergenic
996914919 5:128701068-128701090 ATGTGTGACAATAAGAGAGAGGG - Intronic
998163732 5:139828499-139828521 CTCTGTCACCATCTGAGAATGGG - Intronic
998674556 5:144392502-144392524 CTGTGTGACCAGATGAGAGGTGG + Intronic
1001914026 5:175544401-175544423 CTCTGTGACTATAAAAGATTAGG + Intergenic
1004859750 6:19790746-19790768 CTGTGTGACCTTGAGAGAGCTGG - Intergenic
1008413284 6:51208366-51208388 ATGTCTGAGCATAAGAGAAGAGG + Intergenic
1009584360 6:65578911-65578933 CTGTGTGACCATAAGAGAATGGG - Intronic
1011063121 6:83294300-83294322 CTCTGTAACCTTAAGGGAATTGG - Intronic
1014009566 6:116460570-116460592 CTCTGCTACCTTAAGAGAATTGG - Intergenic
1016139575 6:140592680-140592702 ATGTGTGACCCTAATAAAATGGG - Intergenic
1016141856 6:140622063-140622085 CAGTGCAACCATAAAAGAATCGG + Intergenic
1019923103 7:4175142-4175164 CTGTGTGAGCATAGGAGCATAGG - Intronic
1020750297 7:12132507-12132529 CACTGTCACCAGAAGAGAATGGG + Intergenic
1022452118 7:30525316-30525338 CTGGGTGGCAATGAGAGAATGGG - Intronic
1023426064 7:40037559-40037581 CTGTGTGACCAACAGAATATTGG - Intronic
1025146104 7:56505505-56505527 CTGTGTGAAAATAACTGAATGGG - Intergenic
1025973980 7:66355018-66355040 CTTTATGACCATAAGAGGACAGG + Intronic
1030521532 7:110603944-110603966 CTCTGGGACCCTAAGAGAATGGG + Intergenic
1030801227 7:113855748-113855770 CTGTGTGTCCAAAAGAAAATAGG + Intergenic
1033504610 7:141987330-141987352 TTGTTTGTCCAAAAGAGAATGGG - Intronic
1035372801 7:158390214-158390236 CTGTGTGACCATGAGAGCCGTGG - Intronic
1035950988 8:4020584-4020606 ATCTCTTACCATAAGAGAATTGG - Intronic
1037521024 8:19680923-19680945 CTGTGGTCCCATAAGATAATGGG - Intronic
1039225061 8:35379205-35379227 CTGTGTGACTATAAGTTACTAGG - Intronic
1039236156 8:35504820-35504842 CTGTTTCACCATGAGAGAAGAGG - Intronic
1039766799 8:40637117-40637139 CTGTGTGCCCACATGGGAATGGG - Intronic
1040463139 8:47669441-47669463 CTGTGTGAGCAAAACAGAGTGGG + Intronic
1041568622 8:59310050-59310072 CTGTGTGACAGTAATAGAAGAGG + Intergenic
1044623932 8:94217927-94217949 CTTTGTGACCAGAAAAGAAAAGG - Intergenic
1045918630 8:107503307-107503329 CTGTGTGGCCATGAGAGACTTGG + Intergenic
1050697851 9:8298936-8298958 CTGGGTGACCCAAAAAGAATTGG - Intergenic
1051067776 9:13125247-13125269 CTGTGGGACCATCAGAGACTGGG + Exonic
1051522723 9:18008180-18008202 CTGTGTGACCCTCAGAAAATAGG + Intergenic
1052246311 9:26339951-26339973 CGGTGTGGGCTTAAGAGAATAGG + Intergenic
1056812413 9:89775013-89775035 CAGGGTGACCAGAAGAGAATCGG - Intergenic
1057928325 9:99171762-99171784 ATATGTGACCAGAAGAGAAGGGG - Intergenic
1060736751 9:126071005-126071027 ATGTGTGCCCATAATAGCATTGG - Intergenic
1061092956 9:128437024-128437046 CTGTGAGACCTTTAGGGAATGGG - Exonic
1203439055 Un_GL000195v1:171435-171457 CTGTGTGCACATAAAAGAAAGGG + Intergenic
1186210984 X:7250251-7250273 CCATCTGACAATAAGAGAATTGG + Intronic
1189081317 X:37975605-37975627 CTCTGTGACCATGGGAGGATTGG - Intronic
1191842236 X:65521586-65521608 TACTGTGACCAAAAGAGAATTGG - Intronic
1195958908 X:110364759-110364781 ATATGTGACCATAATATAATGGG + Intronic
1200228548 X:154432595-154432617 CTGTGTGGCCAGAAGAGGAGGGG + Intronic
1201896545 Y:18998295-18998317 CTGTATGTCCATAAAAGAAAAGG + Intergenic
1202270486 Y:23067638-23067660 TTTTGGGACCATAAGAGAAGAGG - Intergenic
1202295541 Y:23353044-23353066 TTTTGGGACCATAAGAGAAGAGG + Intergenic
1202423480 Y:24701382-24701404 TTTTGGGACCATAAGAGAAGAGG - Intergenic
1202447309 Y:24968703-24968725 TTTTGGGACCATAAGAGAAGAGG + Intergenic