ID: 1009585546

View in Genome Browser
Species Human (GRCh38)
Location 6:65597267-65597289
Sequence CTCAATGCTCAAATGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009585546_1009585550 27 Left 1009585546 6:65597267-65597289 CCTACCTTCATTTGAGCATTGAG 0: 1
1: 0
2: 1
3: 6
4: 118
Right 1009585550 6:65597317-65597339 TCGCCCAGAGTAATGTTCCATGG 0: 1
1: 0
2: 0
3: 4
4: 70
1009585546_1009585548 -10 Left 1009585546 6:65597267-65597289 CCTACCTTCATTTGAGCATTGAG 0: 1
1: 0
2: 1
3: 6
4: 118
Right 1009585548 6:65597280-65597302 GAGCATTGAGATTTTTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009585546 Original CRISPR CTCAATGCTCAAATGAAGGT AGG (reversed) Intronic
900804213 1:4756810-4756832 TTCTCTGCTCAAATCAAGGTGGG - Intronic
903706525 1:25289887-25289909 CTCATTGGTCAAAGGAAGGAAGG + Intronic
903724920 1:25433755-25433777 CTCAAAACTCATTTGAAGGTGGG - Intronic
904419291 1:30381246-30381268 CTCCCTGCCCAAATGAAGGCTGG - Intergenic
906812837 1:48846893-48846915 ATCAATGCTCTCATTAAGGTTGG - Intronic
907123555 1:52029467-52029489 CTCAAGGCTCAAATGACAGTAGG + Intronic
910953988 1:92681589-92681611 CTCTTTGCTGTAATGAAGGTTGG - Intronic
911305472 1:96226703-96226725 CTCAATGCTCAAATAAAAAGTGG + Intergenic
911484269 1:98486146-98486168 CTCAGTGGCCAAATGAAGGAGGG - Intergenic
912493890 1:110078922-110078944 CTCATTGCTCAAAAGAAAGTCGG - Intergenic
913003864 1:114608914-114608936 CTGGATGCTGAAAGGAAGGTAGG - Intronic
917694096 1:177502266-177502288 CCCAATTCTCAAAATAAGGTAGG - Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
919502643 1:198356495-198356517 CTCTATGGTCAAATAAATGTGGG + Intergenic
923296124 1:232596604-232596626 ATCAATGTTCATATGAAGGAAGG + Intergenic
1068854186 10:61780577-61780599 CTCAACTCTGAACTGAAGGTGGG + Intergenic
1071489913 10:86129212-86129234 CTGAATGCTCATATGGAGATGGG - Intronic
1074009492 10:109462346-109462368 CTAAATGTGCAAATGTAGGTAGG - Intergenic
1075851647 10:125593084-125593106 CTCCATGCTCCACTGAGGGTGGG + Intronic
1076738269 10:132468321-132468343 CTCAACGCTGAAATGAAAGGAGG + Intergenic
1082822670 11:57554748-57554770 CTCAATTGTCAAATGAATGCAGG - Intronic
1085065637 11:73493156-73493178 CTCAAACCTAAAATGAAAGTAGG + Intronic
1085738111 11:79056958-79056980 CTCAATGCTAACAAGATGGTGGG + Intronic
1086943347 11:92820631-92820653 CTGGAAGCTCAAATGGAGGTTGG - Intronic
1090925521 11:131246734-131246756 CTCAATGCCCAGATGCAGATGGG + Intergenic
1096065344 12:48735220-48735242 CACAAAGCTGAAATCAAGGTTGG - Intergenic
1096438745 12:51619835-51619857 CCCAATCCTCAAATGTTGGTTGG + Intronic
1098464636 12:70772630-70772652 CTCAATGCTTGCATGGAGGTAGG + Intronic
1102306661 12:111810005-111810027 CTCAATAACCAAAGGAAGGTGGG + Intergenic
1105405711 13:20131030-20131052 GTAAATGCTAAAATGCAGGTGGG + Intergenic
1107765821 13:43733417-43733439 CTCTATGCACAAATGAATCTTGG + Intronic
1108760569 13:53558279-53558301 CTCATTGCTTGAATGAATGTTGG - Intergenic
1111279231 13:85997589-85997611 GTAAAGGCTCAAATGATGGTGGG + Intergenic
1116598478 14:46885756-46885778 ATCAATGCTAAAATAAAGCTTGG - Intronic
1118714499 14:68549304-68549326 CTCACTGGTCAAATGAAGTTTGG - Intronic
1120244361 14:81989097-81989119 CTGAAAGCTCAGATGATGGTCGG + Intergenic
1120389827 14:83891703-83891725 CTCAATGATCAAATGACATTGGG + Intergenic
1125909371 15:43422172-43422194 CACAATGCTAATATGATGGTTGG + Intronic
1129248234 15:74292936-74292958 CACAAAGCTAAAATAAAGGTGGG - Intronic
1129330279 15:74823597-74823619 CTCAATGCCCACAGGCAGGTAGG - Exonic
1129881421 15:79009117-79009139 CCCACTGCTTAAATGCAGGTGGG - Intronic
1134383544 16:13750329-13750351 CTAAAAGCTCAAAGGAAGGGCGG - Intergenic
1137377687 16:47967597-47967619 CTCAATGACCAAATCCAGGTAGG - Intergenic
1144059782 17:11572872-11572894 CACAATACTCACATGATGGTTGG + Intergenic
1144093168 17:11875821-11875843 CACAAGGCTAAAATGAAGGGAGG - Intronic
1147561788 17:41513824-41513846 CTCCTTGCTCCAAAGAAGGTGGG + Exonic
1148360808 17:47010612-47010634 CTCCATGTTCTAAAGAAGGTGGG - Intronic
1149392594 17:56206951-56206973 CTCAATGCTCAATCAAGGGTAGG + Intronic
1150047062 17:61924139-61924161 ATCAATGCTGAATTGAATGTAGG - Intronic
1159685724 18:71417550-71417572 CTGAATGCTTAAATGAACGCTGG - Intergenic
1165367739 19:35379541-35379563 CACAATGCCCACATGAAGATGGG + Intergenic
930202699 2:48560314-48560336 CTGAATTCTCAAAGGAAGCTGGG - Intronic
930375536 2:50561122-50561144 CTGAATGCTGGAATGAAGGAAGG - Intronic
930675323 2:54194950-54194972 ATGAATATTCAAATGAAGGTAGG + Intronic
944369990 2:198971788-198971810 CTCATTCCACAAAAGAAGGTGGG + Intergenic
1173811563 20:45959127-45959149 CTCAATGTGCAAATGATGCTGGG + Intronic
1174139525 20:48403367-48403389 CTCAAAGCCCAAATGATGGCTGG - Intergenic
1174325059 20:49772318-49772340 CTCACTACTCAAATGCAGCTTGG + Intergenic
1177096443 21:16840646-16840668 CTCCAGCTTCAAATGAAGGTTGG - Intergenic
1177472846 21:21580999-21581021 CTAAATGTTCAAGTGAAGGGAGG + Intergenic
1177782584 21:25637017-25637039 CTCAATAGTCACATGAGGGTAGG - Intergenic
1183010800 22:34944877-34944899 CTCAATCCTAAAATGCAGATAGG + Intergenic
1183217875 22:36492869-36492891 CTCAATGATCTCATGAAGTTTGG + Intronic
949233684 3:1782506-1782528 ATCAAGGCTAAAATGATGGTAGG + Intergenic
951503269 3:23414406-23414428 CTGAAAGCTCAAATGAGGGAAGG - Intronic
951668573 3:25154839-25154861 CGCCATGCTCAGATGTAGGTAGG - Intergenic
953448945 3:42990538-42990560 CTCAATGCTCAAATGGAGGCCGG - Intronic
959116070 3:102179951-102179973 CTTCATGGTCAAATGAAGCTAGG - Intronic
960188002 3:114667922-114667944 CTCAATCCTCAAATGGAAATGGG + Intronic
960372144 3:116853546-116853568 CTAAATGCTCAAATAGAGGAAGG - Intronic
963489972 3:145987559-145987581 TTCATTCCTGAAATGAAGGTTGG + Intergenic
963545991 3:146658891-146658913 CTCCATGATCAAATGGAGGTGGG - Intergenic
969378687 4:6780189-6780211 CTGATTGCTCAAGGGAAGGTGGG + Intergenic
971516047 4:27488123-27488145 AAGAATGCTAAAATGAAGGTAGG + Intergenic
971640308 4:29123458-29123480 CTTAAAGCTCAATTGAATGTAGG - Intergenic
972874317 4:43339591-43339613 CTCAAGGGTCAAATGCAGGAGGG - Intergenic
973269981 4:48253033-48253055 TTCTATGATCAAATGAAGTTGGG - Intronic
977220402 4:94331702-94331724 CACAATGCTATAATAAAGGTGGG - Intronic
980999478 4:139814759-139814781 CACAAAGCTCAGATGCAGGTAGG - Intronic
982422427 4:155212879-155212901 CTCAATGCTCTAAGGAAACTTGG - Intronic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
989008250 5:36839775-36839797 CTTAATGCTGAAATGAACATGGG + Intergenic
990797998 5:59565828-59565850 CTCAATTCTCATATGAGGGGAGG - Intronic
992022028 5:72634227-72634249 CTCAATTATCAAATGAGGTTGGG + Intergenic
992861644 5:80916824-80916846 CTAAATGCTCAACAGAAGTTTGG + Intergenic
992901018 5:81296417-81296439 CTCAAGGAGCAAATGAAGGAAGG - Intergenic
995294435 5:110502748-110502770 TACAATGCCCAAATGAAGGAAGG - Intronic
995558790 5:113358438-113358460 CCCAGTGCTCAAATGAAGGATGG - Intronic
998301228 5:141022869-141022891 CCCAATTCAAAAATGAAGGTTGG + Intergenic
999527764 5:152426366-152426388 CTCAAAGCTGAACTGAGGGTAGG - Intronic
1001114162 5:168924806-168924828 CTCAAAACTCAAATGCAGCTGGG - Intronic
1001195654 5:169671233-169671255 CTCAATGCTAAAATGAAAACTGG - Intronic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1003706182 6:8533283-8533305 CTGAATGCTCAGATGATTGTTGG + Intergenic
1004152827 6:13136683-13136705 CTAAATGCTCAAGTGAAAGGAGG - Intronic
1005911021 6:30309636-30309658 CCAAATGCTCAGATAAAGGTAGG + Intergenic
1006549260 6:34807300-34807322 CTGAATGGTCAAATGAAAGCGGG + Intronic
1007054227 6:38865948-38865970 CCCAAGTCTCAAAGGAAGGTTGG - Intronic
1009585546 6:65597267-65597289 CTCAATGCTCAAATGAAGGTAGG - Intronic
1011493921 6:87920387-87920409 CTCAATGCTCAACTAGAGGGAGG + Intergenic
1017268862 6:152482710-152482732 CTCCATTCTCAAAGGAAGGCAGG - Intronic
1018276542 6:162138212-162138234 CTCAAAGCTCACACGGAGGTGGG + Intronic
1019954732 7:4404696-4404718 CTCAATTCTCAAACCAAGTTTGG - Intergenic
1020850341 7:13345385-13345407 CTAAATCCTGAAATCAAGGTTGG - Intergenic
1027340044 7:77197420-77197442 CTTAAAGCTCAGGTGAAGGTGGG - Intronic
1028491309 7:91415017-91415039 CTCAATGCTCATAAGGAGGAAGG + Intergenic
1030673741 7:112364239-112364261 CTCAAGGCTGAAACGAGGGTAGG + Intergenic
1035901767 8:3464388-3464410 CCCTATGCTCAATTGAAAGTTGG - Intronic
1037404896 8:18531855-18531877 CTCACTGCTGAAATGAAGAGAGG + Exonic
1041097721 8:54365988-54366010 CTCACTGATCAAATGAGGGAAGG + Intergenic
1043027588 8:75090076-75090098 TTCATTGCTAAAATGAAGGAAGG + Intergenic
1043190597 8:77217441-77217463 TGCAATGATCAAATGAAGGGAGG + Intergenic
1050929661 9:11307575-11307597 CTGAATGCTAAGATGAAGCTGGG - Intergenic
1051967924 9:22851709-22851731 CTAAGTGTTCAAATGAAGGGAGG - Intergenic
1052184998 9:25582540-25582562 CTAATGGCTCAAATGCAGGTAGG - Intergenic
1056248652 9:84725449-84725471 CACCATGCTCAAATGAATTTTGG - Intronic
1057382952 9:94585152-94585174 AACAAAGCTCAAATGAAGCTAGG - Intronic
1189862946 X:45292008-45292030 CTGAATTCTCATCTGAAGGTGGG - Intergenic
1195468754 X:105210388-105210410 CTCAGGGGTCAAATGATGGTAGG - Intronic
1195960307 X:110379047-110379069 CTCACTACTCAAATAAAGTTTGG + Intronic
1198812603 X:140550834-140550856 CTCTGTGCACAAAGGAAGGTTGG + Intergenic
1199544020 X:148988205-148988227 CTCACTACCCTAATGAAGGTGGG + Intronic
1199907768 X:152251859-152251881 ATAAATGTTGAAATGAAGGTGGG - Intronic
1200065544 X:153502681-153502703 CTCAAGGCTCAAAAGAATGAGGG + Intronic
1200166607 X:154039897-154039919 CTCAGTGCTGAAAAAAAGGTGGG + Intronic
1202096849 Y:21260249-21260271 CTAAATTCTCAGATGAAGATTGG - Intergenic