ID: 1009588050

View in Genome Browser
Species Human (GRCh38)
Location 6:65631410-65631432
Sequence CTTTGGTCCTTGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009588047_1009588050 3 Left 1009588047 6:65631384-65631406 CCAGCTACTGTGAAAAGTAATAT 0: 1
1: 0
2: 1
3: 38
4: 279
Right 1009588050 6:65631410-65631432 CTTTGGTCCTTGAATGAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 188
1009588045_1009588050 20 Left 1009588045 6:65631367-65631389 CCAGTGTGTTATTTCCTCCAGCT 0: 1
1: 0
2: 5
3: 22
4: 238
Right 1009588050 6:65631410-65631432 CTTTGGTCCTTGAATGAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 188
1009588046_1009588050 6 Left 1009588046 6:65631381-65631403 CCTCCAGCTACTGTGAAAAGTAA 0: 1
1: 0
2: 1
3: 17
4: 212
Right 1009588050 6:65631410-65631432 CTTTGGTCCTTGAATGAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 188
1009588044_1009588050 23 Left 1009588044 6:65631364-65631386 CCTCCAGTGTGTTATTTCCTCCA 0: 1
1: 0
2: 3
3: 16
4: 209
Right 1009588050 6:65631410-65631432 CTTTGGTCCTTGAATGAGGATGG 0: 1
1: 0
2: 2
3: 20
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009588050 Original CRISPR CTTTGGTCCTTGAATGAGGA TGG Intronic
901744924 1:11366016-11366038 CTTTGGACTTTGAATGGGAAGGG + Intergenic
903972490 1:27128162-27128184 CTCTGGTCCATCAATGAGGGAGG + Intronic
904797286 1:33066209-33066231 CTTTTTTCCTTGAATGTGTATGG - Intronic
906571348 1:46844271-46844293 CTTTGGGCCTGTCATGAGGATGG + Intergenic
906577552 1:46904402-46904424 CTTTTTTCCTTGAATGTGTATGG - Intergenic
906599925 1:47116971-47116993 CTTTGGGCCTGTCATGAGGATGG - Intronic
912463119 1:109850547-109850569 CTTAGCTCCTTGTGTGAGGAAGG + Intergenic
915244473 1:154546608-154546630 CTTGGGTCATTGCATGAAGAGGG + Intronic
917958331 1:180123124-180123146 CATTGGACCTTGTGTGAGGACGG - Intergenic
918086405 1:181249034-181249056 CTTTTTTCCTTGAATGTGTATGG - Intergenic
918405403 1:184207413-184207435 ATTTGATCCTTAAATGAGGTAGG + Intergenic
918739043 1:188103611-188103633 CTTTGGGCCTTCAATGGGGGAGG + Intergenic
919533371 1:198754125-198754147 ATTTGGTTCTTGAAAGAGGTTGG + Intronic
920383727 1:205552108-205552130 CTTTGGTCATTGAATATTGAAGG - Intergenic
920548573 1:206838993-206839015 CTTTGCTTCTTGAATGAAGATGG + Intronic
920986987 1:210900236-210900258 CCTTGGTACGTGAATGGGGATGG - Intronic
921596955 1:217064909-217064931 CTCTGGGCTTTTAATGAGGAAGG + Intronic
1063231448 10:4069390-4069412 CTTTGGTCTTTGGAACAGGAAGG - Intergenic
1064204961 10:13315010-13315032 CTCTGTGTCTTGAATGAGGATGG - Intergenic
1065498511 10:26354864-26354886 TCTTGGTCCTTTAATGAGGAGGG - Intergenic
1066707720 10:38199848-38199870 CTTTGTTCCTTGGATGATGTGGG + Intergenic
1067083983 10:43228534-43228556 CCTGGGTCCCTGAATGAGGGTGG + Intronic
1068614642 10:59099809-59099831 CTTTGGCCATAAAATGAGGATGG - Intergenic
1070192420 10:74124153-74124175 TTTTGGTGCTTAAATGAGGGCGG + Intronic
1071384443 10:85105220-85105242 CTTTGGTCCTGGAGTGAGAAAGG - Intergenic
1075510220 10:123066504-123066526 CTTTGGGCTTTGAAGGAGTATGG + Intergenic
1076282239 10:129257839-129257861 ATTGGGTCCTTGGTTGAGGAGGG + Intergenic
1078654751 11:13227968-13227990 CTCTGGTCCTTGGATGACAATGG - Intergenic
1081674211 11:44958962-44958984 CCATGGTCCTGGAGTGAGGAAGG + Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1082296008 11:50441769-50441791 CTTTTTTCCTTGAATGTGTATGG - Intergenic
1082709064 11:56530704-56530726 CTTGGGTCTTTGAATAAGGAAGG - Intergenic
1084502940 11:69545589-69545611 CCTTGGGCCTTGTATGAGGTTGG + Intergenic
1085486451 11:76867822-76867844 CTTTTGTCCATGAGTGAGAATGG + Intronic
1087529773 11:99364930-99364952 CTCTGGTACCTGAATAAGGATGG + Intronic
1087680896 11:101217609-101217631 CTTTTTTCCTTGAATGGGTATGG + Intergenic
1087807011 11:102566055-102566077 CTTTGGTCCCTAAACAAGGAGGG - Intergenic
1088551642 11:111019432-111019454 CCTTGGTCTTTGAATGGTGAAGG + Intergenic
1091845709 12:3654765-3654787 CCTTGGTCCTTGATGGAGAAGGG + Intronic
1091996872 12:5000718-5000740 CTGTGGTCATTGAATGAGTCTGG - Intergenic
1092169243 12:6363106-6363128 TTCTGGTCCTTGATTCAGGAAGG - Intronic
1092771985 12:11905044-11905066 TTTTTTTCCTTGAATGATGAAGG - Intergenic
1092823848 12:12378645-12378667 ATTGGGTCCTAGAATGAGAAAGG + Intronic
1093786221 12:23194849-23194871 ATTTGGCCCTAAAATGAGGATGG + Intergenic
1094092178 12:26662509-26662531 GTTTGGTCCATGAAGAAGGATGG - Intronic
1096189079 12:49603198-49603220 CTTTTGTCCTTCAATGAGAGTGG + Exonic
1098046844 12:66409155-66409177 CTTTGGTCCTTGAGTGAACATGG + Intronic
1098904948 12:76152484-76152506 CTGGGATCCTTGAATGAGGTAGG - Intergenic
1099555720 12:84106409-84106431 CTTTCTTCCTTGAATGTGTATGG + Intergenic
1101504989 12:105337849-105337871 CTTTGATCTTTGAACAAGGATGG + Intronic
1102548013 12:113670530-113670552 CTTTGAGCTTTGAGTGAGGATGG - Intergenic
1103487847 12:121295485-121295507 CTTTGTTCCTTGGAGGAGGCGGG - Intronic
1105658490 13:22466823-22466845 CTTTCTTCTTTGAATTAGGAAGG + Intergenic
1105717398 13:23081099-23081121 CTCTAGCCCTGGAATGAGGAGGG - Intergenic
1106713535 13:32364335-32364357 CTTGGGACCATGAATGAGGATGG - Intronic
1107118499 13:36773101-36773123 CTGTGGGCCTGGAATGAGTAGGG + Intergenic
1107465343 13:40644744-40644766 CTTTTGTGCTTGAATGAGGATGG - Intronic
1108200957 13:48042525-48042547 CTTTGGTCCCTTAACAAGGAGGG + Intronic
1109054341 13:57527889-57527911 CTTTGGTCCCTGAACAAGGAGGG + Intergenic
1109771106 13:66974428-66974450 CTATAGTCTTGGAATGAGGAAGG + Intronic
1110294316 13:73844703-73844725 TTTTGGTTCTTGTATGAGGTGGG - Intronic
1110953281 13:81521436-81521458 CTAAGGTCCTGGAATGAGAAGGG + Intergenic
1112182642 13:97099628-97099650 CATTGGTAGTTTAATGAGGATGG + Intergenic
1112400965 13:99077959-99077981 TAGTGGTTCTTGAATGAGGAAGG + Intronic
1112668498 13:101606731-101606753 CTTGGCTCTCTGAATGAGGATGG + Intronic
1112720562 13:102239527-102239549 CTTTGGAATTTGAATGAGGCTGG + Intronic
1113362359 13:109643238-109643260 CTTTCATCAGTGAATGAGGAAGG - Intergenic
1113868530 13:113544307-113544329 CTTTAGGCCCTGAGTGAGGAAGG + Intronic
1114751845 14:25213122-25213144 CAGTGCTGCTTGAATGAGGAAGG - Intergenic
1115420074 14:33184153-33184175 GATTGGTCCTTGAATAGGGAGGG + Intronic
1116921022 14:50575028-50575050 CTCTGGTCCTTGATTTAGGAAGG + Intronic
1117196048 14:53341176-53341198 CTTTTTTCCAAGAATGAGGAAGG - Intergenic
1122955811 14:105070456-105070478 CTGTGTTCCAGGAATGAGGAAGG + Intergenic
1125141767 15:36416367-36416389 CACTGGTCACTGAATGAGGAAGG + Intergenic
1127405220 15:58637306-58637328 GCTTGGTCGTTGAATGAGGCTGG - Intronic
1128298940 15:66551550-66551572 CTTTCCTCCATGAAAGAGGACGG - Intronic
1129858862 15:78844645-78844667 CTGTGGCCAGTGAATGAGGATGG - Intronic
1130131296 15:81145000-81145022 CTCTGGTCCTTGAAATAGGGAGG - Intronic
1131708436 15:95024443-95024465 CGTTTGTCCTTGGATGAGGTTGG + Intergenic
1131818491 15:96247086-96247108 GTTTGGTGGTGGAATGAGGAGGG - Intergenic
1133202305 16:4211402-4211424 CTGTTGTCCTTCAATGATGATGG + Intronic
1137580827 16:49632534-49632556 CTTTGGGCCTTGTGTGAGCAGGG - Intronic
1142828212 17:2528032-2528054 CTGGGGTCCTTGAATATGGATGG - Intergenic
1144575898 17:16429224-16429246 CTTTGCTCCTTGCTTGTGGAAGG - Intronic
1145923975 17:28632380-28632402 CTTAGATCCTTGAAAGAAGAGGG - Intronic
1146465647 17:33084134-33084156 CTTATGTCCTTGAGTGAGCAGGG + Intronic
1147417162 17:40300512-40300534 CTCTGGTCCTTTCATGAGGTGGG + Intronic
1149003824 17:51783957-51783979 CTGGGCTCCTTGAAAGAGGAGGG + Intronic
1149444721 17:56704825-56704847 CTGTGGGCCTTGAAAGAGAAAGG + Intergenic
1149477275 17:56973712-56973734 CTCTGGTCCTTGAATGCACAGGG - Intergenic
1149992959 17:61392969-61392991 CTTTTGTCCTGGAATTTGGATGG + Intergenic
1153231431 18:2940563-2940585 CTTGGTTTCTTGAAAGAGGAAGG - Intronic
1154057994 18:11030122-11030144 CTTTGTGGCTGGAATGAGGATGG - Intronic
1157372470 18:47128483-47128505 CTTTGGCCTTTGGTTGAGGAGGG - Intronic
1157720011 18:49916432-49916454 CTGTGGTGCTTGTATGAGGTGGG - Intronic
1160243681 18:77140568-77140590 CTGTGCCCCTTGAAGGAGGAAGG - Intergenic
1162829957 19:13278219-13278241 CTTTTATCCCTGAATGAGGTGGG - Intronic
1164378179 19:27708109-27708131 TTTTGGACATAGAATGAGGAAGG + Intergenic
1167143817 19:47670614-47670636 CCTTGGCCCCTGGATGAGGAAGG + Intronic
926189439 2:10717196-10717218 CTTTGGGCCCTGAAGAAGGATGG + Intergenic
930041433 2:47128350-47128372 CTTTGGGCCTTGAGTGAACATGG - Intronic
930796730 2:55400643-55400665 ATTTGGTCCTTGTATGATCAAGG + Intronic
931599858 2:63992278-63992300 CTTTTTTCCTTGAATGTGTATGG - Intronic
934131767 2:88955530-88955552 CTTAGGCCCTGGAGTGAGGAGGG - Intergenic
934136027 2:88997346-88997368 CTCAGGTCCTGGAGTGAGGAGGG - Intergenic
934688439 2:96338595-96338617 CAGTGGTCCTTGTAAGAGGAAGG + Intronic
936795175 2:116195637-116195659 CTTGGGTCCTTGAGTGAACATGG - Intergenic
937308543 2:120887120-120887142 CTGTGGTCCTTGAAAGCAGATGG + Intronic
939050439 2:137300940-137300962 CTTTGGTGCTGGCATGATGAGGG + Intronic
941580819 2:167293639-167293661 CTTGGGTCCTTGAAGGACGTCGG - Intergenic
944641581 2:201731902-201731924 CTTTTGTCCCAGAATGAGGATGG + Intronic
945094494 2:206206061-206206083 TTTTGGTAGTTGAATGGGGAAGG - Intronic
946137946 2:217663653-217663675 CTTTGGTCTTGGATTCAGGAAGG - Intronic
1169746821 20:8951500-8951522 ATCTGGTCCTGGAATGATGAGGG + Intronic
1170348030 20:15408511-15408533 CTTTTGATCTTAAATGAGGAAGG + Intronic
1170354530 20:15477826-15477848 CAATGGTCCTTATATGAGGAAGG + Intronic
1171187052 20:23130084-23130106 CTTTGGTCCTGGACTAGGGAAGG - Intergenic
1172550634 20:35796740-35796762 CTTTGGTCAGAGAAAGAGGAAGG + Intronic
1173445869 20:43117572-43117594 CTTTGGTGCGTGGATGAGGATGG - Intronic
1179238688 21:39569374-39569396 CTTTGGTCCTTGAATATGCCAGG + Intronic
1179668466 21:42928752-42928774 TTTTGGTCCCTGAGCGAGGAGGG - Intergenic
1180991302 22:19938445-19938467 CTTTTTTCCTTGAATGTGTATGG - Intronic
949108042 3:224168-224190 TTTTGGTCCCTGAACAAGGAGGG + Intronic
951194658 3:19810698-19810720 CTTGGGTCCTTAGATGAAGAAGG + Intergenic
954163462 3:48738520-48738542 ATGTGGTCCTTGAAGCAGGAGGG + Intronic
954937971 3:54344374-54344396 ATTTGGTGATTGAATGAGGGAGG + Intronic
956570240 3:70686659-70686681 TTTAGGGCCTAGAATGAGGAAGG - Intergenic
956596333 3:70971396-70971418 ATTTGGTCCGTGAATGGAGATGG - Intronic
956953072 3:74304614-74304636 CTTTGTTTCTTGAAGGAGTAAGG + Intronic
959888152 3:111525864-111525886 CTTTTTTCCTTGAATGTGTATGG - Intronic
961360197 3:126362276-126362298 CTTTGGTCTCTGAATGAGTTTGG + Intergenic
961581472 3:127886869-127886891 CTTTGGTCTCTGAAAAAGGAGGG - Intergenic
962200443 3:133396809-133396831 ATTTGATCCTTGAAGAAGGAAGG - Exonic
962573038 3:136730342-136730364 CTTGGGTTCTTGAATTTGGATGG - Intronic
964476804 3:157105004-157105026 CTTTGGTCCTTGAAGGCTCATGG - Intergenic
968163352 3:196444978-196445000 TTTTGGTCCTTGAGCAAGGAGGG - Intergenic
970713095 4:18887484-18887506 CTTTATTCCCTGAATAAGGAGGG - Intergenic
971583918 4:28380637-28380659 CTTAGGTTCTTTAAAGAGGATGG - Intronic
971849858 4:31970484-31970506 CTTTGATCCTTGATTTAGGCAGG + Intergenic
972948409 4:44286753-44286775 CTTTGCTCCTGGAAAGAGGATGG + Intronic
974789552 4:66669612-66669634 CTTTTCTCCTTGTATGGGGAGGG + Intergenic
977761632 4:100744808-100744830 CTTTGATCATTGACTGAAGAAGG + Intronic
979505404 4:121489936-121489958 CTCTGGTACTTGAATGTGGATGG + Intergenic
980227773 4:130010431-130010453 CTTTTGTCTTTGTATGTGGAAGG + Intergenic
980381764 4:132030213-132030235 CTTGGGACATTGAATAAGGAAGG - Intergenic
981685270 4:147447363-147447385 CTTTGGGACTTGAATAAGCATGG - Intergenic
981704702 4:147647038-147647060 TTTTGGTCCCTGAACAAGGAGGG - Intronic
982490107 4:156019675-156019697 CTTTTGTCTTTGACTGAAGATGG + Intergenic
983291378 4:165810640-165810662 TTTTGGTCCTTGTCTGGGGAAGG + Intergenic
985155136 4:186979648-186979670 CTTGTGTCCTGGAATGATGACGG + Intergenic
985751657 5:1682138-1682160 CTTTGGTCCTTCTTTGTGGATGG + Intergenic
986073407 5:4310226-4310248 CTTTAAACCTTGAATGATGAAGG - Intergenic
987767398 5:22250682-22250704 CTTTGGTTCTTCACTAAGGATGG + Intronic
988340622 5:29966139-29966161 CTGTGGTTCCTGAATGTGGATGG - Intergenic
988681947 5:33492111-33492133 CTTTGGTCCTTGAGCAAGGAGGG + Intergenic
989318280 5:40106618-40106640 CTTTCTTCCTTGAATGTGTATGG - Intergenic
989958994 5:50388013-50388035 CTTTGGTCTTTGAAGTCGGATGG - Intergenic
999628316 5:153543562-153543584 GTTGGTTACTTGAATGAGGAAGG + Intronic
1000671376 5:164067085-164067107 ATTGGATCATTGAATGAGGAGGG + Intergenic
1007444690 6:41895679-41895701 CTCTGGCCCTTTAAGGAGGAGGG - Intergenic
1009588050 6:65631410-65631432 CTTTGGTCCTTGAATGAGGATGG + Intronic
1009657634 6:66567428-66567450 CTAAGGTCCTTTAATGAGAAGGG + Intergenic
1010300259 6:74251818-74251840 CTTAGGTCCTAGAAGGTGGAGGG - Intergenic
1010923542 6:81714763-81714785 CTTTGGGCATTGAAAGAGAAAGG + Intronic
1011324005 6:86129367-86129389 CTTGGGTCCTAGAAAGTGGATGG - Intergenic
1012778422 6:103526485-103526507 CTTTGGTAGTTTGATGAGGATGG - Intergenic
1015195389 6:130520159-130520181 ATTTGGTATTTGAATGAGTAAGG + Intergenic
1015934781 6:138397745-138397767 CTTTGGTCAATGAAAGTGGATGG + Intergenic
1016014946 6:139174084-139174106 CTTTGTTACTTGAATTTGGATGG + Intronic
1016502800 6:144741367-144741389 CTTTGATTCTTGAAAGAGAAAGG + Intronic
1016580913 6:145628728-145628750 CTTTGGTCATCCAATAAGGATGG - Intronic
1017850705 6:158303061-158303083 CTTTTTTCCTTGAATGTGTATGG + Intronic
1018055808 6:160051282-160051304 CTTTGGAGCCTGAATGAGGAAGG + Intronic
1019299078 7:294486-294508 CTTCGGTCCTTGATTGAGCAGGG + Intergenic
1020140854 7:5610817-5610839 CCTGGGTCCTGGGATGAGGAGGG - Intergenic
1020269014 7:6581174-6581196 CTTTGATCCCTGAAGGAGGGGGG - Intronic
1020677551 7:11198892-11198914 CTTGGGTCCCTGAATGATTATGG + Intergenic
1022793968 7:33717430-33717452 CTCTGGTTCTTGAATCAGGATGG + Intergenic
1024552920 7:50578447-50578469 CTTTTTTCCTTGAATGTGTATGG - Intergenic
1027465814 7:78513683-78513705 ATTTGATCCATGAGTGAGGAAGG - Intronic
1030164422 7:106539491-106539513 TTGTGGTCTCTGAATGAGGAGGG - Intergenic
1030878638 7:114848476-114848498 CCTGGATCCTTGAATGAAGAAGG + Intergenic
1033005272 7:137554759-137554781 CTTTGTTCCAGGAATGAGGCTGG - Intronic
1034013066 7:147551378-147551400 CTCTGGTCCTTGATTGTGTAAGG + Intronic
1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG + Intergenic
1036797801 8:11768764-11768786 CTTTAGTTCTCGAAGGAGGATGG - Intergenic
1039381190 8:37087072-37087094 GTTTGGTCCCTGAACAAGGAGGG - Intergenic
1041147828 8:54896749-54896771 TTTTGGTAATAGAATGAGGAGGG - Intergenic
1043870470 8:85426204-85426226 CTTGCTTCCTTTAATGAGGAGGG + Intronic
1045054081 8:98354305-98354327 GCTTAGTCCTTGGATGAGGAAGG - Intergenic
1046190614 8:110790077-110790099 CTTTGGTCCCTGAGCAAGGAGGG + Intergenic
1046392908 8:113600412-113600434 CTTTGCCCCATGAAAGAGGATGG - Exonic
1047130078 8:122008977-122008999 CTTTGGTGCAATAATGAGGAAGG + Intergenic
1047788064 8:128173725-128173747 CTTTTCTCCTTGAATGGGGAAGG - Intergenic
1048565898 8:135596902-135596924 CTCTGGGCCTTAAATGAGCAAGG - Intronic
1048694979 8:137017020-137017042 CCTTGGTCCTTTACTGTGGATGG + Intergenic
1052698453 9:31908898-31908920 TTTTGGGACTTGAATGAGGAAGG + Intergenic
1052975202 9:34405183-34405205 CTTTGGTCCCTGAAGGGAGAGGG + Intronic
1053476674 9:38386973-38386995 CTCTGGTCCTGGGATGAAGATGG + Intergenic
1058846083 9:108960814-108960836 CTGTGGTCCTTGTATTAGAAGGG - Intronic
1059198891 9:112396383-112396405 CTTTTTTCCTTGAATGTGTATGG + Intronic
1059794677 9:117680044-117680066 CTTTGGTCCTCAAAGGAAGAAGG - Intergenic
1060552187 9:124490925-124490947 CTTTGTTCACTGAATGAGTAAGG + Intronic
1186236843 X:7521227-7521249 CATTGGTCCTTGCATGAAGGTGG + Intergenic
1188823081 X:34798495-34798517 CTTTTTTCCTTGAATGTGGATGG - Intergenic
1189978707 X:46488185-46488207 CTTTTTTCCTTGAATGTGTATGG + Intronic
1190816622 X:53935360-53935382 CTTTGTCCCTTGACTGAGGAAGG + Intergenic
1190872124 X:54433208-54433230 CTTAGCTCCTTGAAGGAGTATGG - Intergenic
1194620091 X:96160564-96160586 TTTTGGTCCTTGAGCAAGGAGGG + Intergenic
1194736508 X:97518697-97518719 CTTTAGTCCTTGAATGAGCAGGG + Intronic
1201016258 Y:9605320-9605342 TTTTGATCCTTCCATGAGGAAGG + Intergenic