ID: 1009588130

View in Genome Browser
Species Human (GRCh38)
Location 6:65632822-65632844
Sequence ATTTCTTCACCTATGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 11, 3: 45, 4: 386}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009588130_1009588134 20 Left 1009588130 6:65632822-65632844 CCATGTTCCATAGGTGAAGAAAT 0: 1
1: 0
2: 11
3: 45
4: 386
Right 1009588134 6:65632865-65632887 TAACTTTCCCTGAATTTCAGAGG 0: 1
1: 0
2: 0
3: 21
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009588130 Original CRISPR ATTTCTTCACCTATGGAACA TGG (reversed) Intronic
901223182 1:7595723-7595745 ATTTCCTCATCTCTGAAACAAGG - Intronic
901270254 1:7947368-7947390 GTTTCCTCACCTGTGAAACAGGG - Intergenic
901434893 1:9241292-9241314 ATTTCTTCATCTACAAAACAGGG - Intronic
901616514 1:10544276-10544298 ATTTCTTCATCTATGTAAAATGG - Intronic
903951574 1:26998794-26998816 GTTTCTTCACCTGTGGAAATGGG - Intronic
903962796 1:27067389-27067411 ATTTCTTATCTTCTGGAACAGGG - Intergenic
904447421 1:30586539-30586561 ATTTGCTCACCTATAAAACAGGG + Intergenic
905361224 1:37422236-37422258 GTTGCTTCACCTGTAGAACAGGG + Intergenic
906808791 1:48805470-48805492 ATTTCCTCAACTATGGAACAGGG + Intronic
907661150 1:56393529-56393551 CTTTCCTCACCTATAGAACAAGG + Intergenic
908383314 1:63617073-63617095 ATTTTCTCACCTTTGAAACAGGG - Intronic
908578269 1:65485194-65485216 ATTTCTTCATCTATAAAACAGGG + Intronic
908748324 1:67396738-67396760 ATGTCTTCATCTATAGAACTAGG - Exonic
909207925 1:72783754-72783776 ATTTCTTCATCTATAGACCAGGG - Intergenic
909228328 1:73054608-73054630 CTTGCTTTACCTATGTAACATGG - Intergenic
909580687 1:77230315-77230337 ATTTCTGCCCTCATGGAACAAGG + Intergenic
910060825 1:83089676-83089698 AGTTCTTCAGCTGTGGAACTTGG - Intergenic
910991599 1:93062176-93062198 ATTTCTTCATCTATAAAGCAAGG - Intergenic
911792267 1:102032319-102032341 AACTCTTCACCTATAGAAAAGGG - Intergenic
912909856 1:113747005-113747027 ATTCCTTCACCTATAAAAAAGGG + Intronic
913068858 1:115282260-115282282 ATTTCTTCATCTGTGAAATATGG - Intergenic
913465419 1:119136830-119136852 ATTTCTTCACGTTTGAAATAAGG + Intronic
914371289 1:147026801-147026823 GTTTCCTCAGCTATGAAACAAGG + Intergenic
914981390 1:152417708-152417730 ATTTCTTCATCTATGAAATTGGG - Intergenic
915718748 1:157968025-157968047 TTTTCTTCAGCTATGGAACGGGG + Intergenic
916159689 1:161896827-161896849 ATTTCTTCATCTATAAAACAAGG - Intronic
916816786 1:168361964-168361986 ATTTCCTCCTCTATGAAACAGGG + Intergenic
916834648 1:168531431-168531453 ATTTCTTCATCTATGAAATGAGG - Intergenic
917188645 1:172389964-172389986 AGTTCTTTATCTATGAAACAGGG + Intronic
917236310 1:172895894-172895916 ATTTCTTCACCTTTTGAACTTGG + Intergenic
917747717 1:178026933-178026955 GTTTCTTCATCTATAAAACAAGG - Intergenic
919499498 1:198318195-198318217 ATTTCTTCATCTATTAAATAGGG - Intronic
920006343 1:202836308-202836330 GTCTCTCCACCTATGAAACAGGG + Intergenic
920809001 1:209264597-209264619 ATTTCCTTATCTATGAAACAGGG + Intergenic
920809463 1:209268464-209268486 ATTTCCTTATCTATGAAACAGGG + Intergenic
920831257 1:209467636-209467658 ATAGCTTCAGTTATGGAACAGGG - Intergenic
921236207 1:213133717-213133739 TTTTCTCCACCTATAAAACAGGG - Intronic
921358671 1:214309978-214310000 ATTTCTTAAAATGTGGAACAGGG - Intronic
921798218 1:219372411-219372433 ATTACTTCACCTATGGGTCTTGG - Intergenic
922246588 1:223804810-223804832 GTTTCTTCATCTATAAAACAGGG + Intronic
922418504 1:225443417-225443439 GTTTCTTCACCTGTGGAATGGGG - Intergenic
924458672 1:244238822-244238844 CTTTCTTCACTAATGGAAGAAGG - Intergenic
1063728167 10:8663404-8663426 ATTTCCACACCTATGGCATAAGG + Intergenic
1063787618 10:9402991-9403013 GGTTCTTCCCCTGTGGAACAGGG + Intergenic
1064288184 10:14010999-14011021 GTTTCTTCACCACTGAAACAGGG - Intronic
1064385239 10:14884845-14884867 GTTTCTTCATCTTTGAAACAAGG + Intronic
1064580103 10:16785279-16785301 AGTTCTTCACCTTTGGAACTTGG + Intronic
1064752579 10:18546492-18546514 ATTTCCTCATCTATTAAACAAGG + Intronic
1067159539 10:43812520-43812542 ATTTCTTCAGTTTTGGAACTGGG - Intergenic
1067377361 10:45740234-45740256 ATGTCTTCACCTTTGGTTCAAGG - Exonic
1067885066 10:50080919-50080941 ATGTCTTCACCTTTGGTTCAAGG - Exonic
1068397265 10:56479947-56479969 ATTTCTTTAACCATAGAACATGG - Intergenic
1070643596 10:78186216-78186238 ATTTCCTCACCTTTGAAACAGGG - Intergenic
1071375319 10:84996334-84996356 ATTTCTTTATCTATAAAACAGGG - Intergenic
1071836047 10:89417966-89417988 ATTTTTTCTCCTATAGAACTTGG - Exonic
1072162140 10:92778055-92778077 ATTTCCTCATCTATAAAACAGGG + Intergenic
1073194871 10:101681983-101682005 ATTTCTTCACCTATAAAATAAGG + Intronic
1073464408 10:103685711-103685733 ATTTCTTCACCTGTAAAATAGGG - Intronic
1076648649 10:131971880-131971902 CTTTCTTCACCAAGGAAACAAGG - Intronic
1078943832 11:16040787-16040809 GTTTCTTCATCTGTGAAACAAGG + Intronic
1079473504 11:20803964-20803986 GTTTCTTCAGCTTTGGAACTCGG + Intronic
1079793917 11:24774227-24774249 AATTCTTCAGCTCTGGAACTCGG + Intronic
1079924199 11:26472412-26472434 ATTTCCTCACCTATGAAATGGGG - Intronic
1080720040 11:34839778-34839800 ATTTCTTCATCTATAAAACAAGG + Intergenic
1080815427 11:35751895-35751917 ATTTCCTCATCTATGTAATATGG - Intronic
1081086230 11:38804530-38804552 ATTTCTTCACTGATGGTTCAAGG + Intergenic
1081287188 11:41285291-41285313 ATTTCTTCACGTATAAAACTGGG + Intronic
1081290977 11:41325482-41325504 ATTTATTATCCTATGGAATAGGG + Intronic
1081441959 11:43090632-43090654 ATTTCTTTATCTCTGGAACCTGG - Intergenic
1081458638 11:43250365-43250387 ATTTCTTTTGCTATGGAAGAAGG - Intergenic
1082624679 11:55468773-55468795 ATTTCTTCATGTATGGTGCAGGG + Intergenic
1082727243 11:56751060-56751082 ATTTCTTAAGCTATAGATCAAGG + Intergenic
1083215189 11:61214295-61214317 GTTTATTCAGCTATGGAAAATGG - Intergenic
1083218073 11:61233124-61233146 GTTTATTCAGCTATGGAAAATGG - Intergenic
1083221056 11:61252870-61252892 GTTTATTCAGCTATGGAAAATGG - Intergenic
1083918917 11:65769867-65769889 ATTTCATCACATATGAACCAAGG - Intergenic
1084106227 11:66982537-66982559 ATTTCTTCACCTGTAGAATGAGG - Intergenic
1085069849 11:73534061-73534083 ATTTCTTCACCTGTCAAACAGGG + Intronic
1085964842 11:81510298-81510320 CTTTCTTTACCTACAGAACAAGG - Intergenic
1086239014 11:84666777-84666799 ATTTCTTCAGCCATGAAATAGGG - Intronic
1086332526 11:85768415-85768437 GTTTCTTCATCTATTCAACATGG + Intronic
1087510546 11:99086952-99086974 TTTTCTTCATCTATGAAATAGGG - Intronic
1087947371 11:104179245-104179267 GCTTCTTCATCTATGAAACAGGG - Intergenic
1088105935 11:106206899-106206921 ATTTGTTCACCTGTAGAATAGGG - Intergenic
1090039426 11:123276995-123277017 ATTTCCTCATCTATAAAACAGGG + Intergenic
1091192123 11:133704857-133704879 TTTTCTTCATCTATGGAACAGGG - Intergenic
1091365359 11:135015423-135015445 ACTGCTGCTCCTATGGAACAGGG + Intergenic
1091801170 12:3325544-3325566 GTTTCTTCACCTCTCGAAGAAGG + Intergenic
1091981898 12:4871328-4871350 ATTTCCTGTCCTATGGAATATGG + Intergenic
1092040227 12:5377828-5377850 ATTCCTGCCCCTATGGAAGAGGG + Intergenic
1093884530 12:24444328-24444350 GTTTCTTCATCTATGGAGTAGGG - Intergenic
1094019951 12:25903572-25903594 ATTTCCTCATCTATAAAACAGGG + Intergenic
1094102108 12:26775821-26775843 AGTTCTTCAGCTATGGGACTCGG + Intronic
1095558411 12:43536440-43536462 ATTTATACTCCTATGGAAAAAGG + Intronic
1097518585 12:60638668-60638690 AGTTCTTCAGCTTTGGAACTAGG + Intergenic
1097616188 12:61886956-61886978 ATTTATTCAACTATGAAATAAGG + Intronic
1098002287 12:65957912-65957934 ATTTCTTTACCTATGATTCAAGG - Intronic
1098178378 12:67818624-67818646 GTTTCTTCACCTATGACAAATGG + Intergenic
1098611918 12:72469088-72469110 ATTCCCTCACCTATGAAATAAGG - Intronic
1098768247 12:74517391-74517413 AGTTCTTCAGCTTTGGAACTCGG - Intergenic
1099114096 12:78602346-78602368 ATTTTTTCATCTATGCAAAAGGG - Intergenic
1099135372 12:78891604-78891626 ATTTATTTACATATGGAAGAAGG + Intronic
1099627927 12:85099650-85099672 ATTTCTTCATCAAAGGCACAAGG + Intronic
1100148572 12:91707943-91707965 ATTTCTTCACATACAAAACAGGG - Intergenic
1100437747 12:94587316-94587338 ATTTCTGAATCTATAGAACAAGG + Intronic
1100649613 12:96570637-96570659 ATTTCTTCATCTGTGAAACAGGG + Intronic
1101827179 12:108229544-108229566 GTTTCCTCACCTATAAAACAGGG - Intronic
1101970087 12:109306960-109306982 GTTTCCTCACCTATACAACAGGG + Intronic
1104402058 12:128484452-128484474 ATATCATCATATATGGAACATGG - Intronic
1104786541 12:131453575-131453597 ATTTCTTCACTTATAGTATAGGG - Intergenic
1104880747 12:132068758-132068780 ATTTATTTACCTCTGGAAGAAGG + Intronic
1105786531 13:23755260-23755282 ACTACTTCACCTCTGGCACATGG + Intronic
1106321503 13:28643819-28643841 ATTTCCTTAGATATGGAACACGG - Intergenic
1107339135 13:39387586-39387608 TTTCCTTCACCTATTAAACAGGG - Intronic
1108390076 13:49938207-49938229 ATTTCTTCACCTATAAAATGGGG - Intergenic
1108464818 13:50704868-50704890 ATTTCCTCATCTATGTAAGAGGG - Intronic
1108684334 13:52805628-52805650 ATTTCCTAACCTATGGAACAGGG + Intergenic
1109915266 13:68976672-68976694 ATTTCATCATCTATGCAAAAGGG + Intergenic
1110237218 13:73229488-73229510 ATTTCTTCATGTATGGAAAGTGG - Intergenic
1110754099 13:79151699-79151721 ATTTCTTCATATAGGAAACAAGG + Intergenic
1112045957 13:95598003-95598025 ATTTGTTTAGCAATGGAACAAGG + Intronic
1112698138 13:101973570-101973592 ATTTCTTCAGTTTTGGAACTCGG - Intronic
1112875752 13:104036548-104036570 ATTTCTTCAGTTTTGGAACTCGG - Intergenic
1114532395 14:23404069-23404091 GTTCCTTCACCTGTGAAACAGGG - Intronic
1114775018 14:25472148-25472170 CTTTCTTCCTCTCTGGAACAGGG + Intergenic
1114909975 14:27179684-27179706 ACCTCATCACCTATGGAACATGG - Intergenic
1115343139 14:32313730-32313752 GTTTCTTCATCTATTGAAAAGGG - Intergenic
1115771634 14:36667965-36667987 ATTTCTTCATCTTTAAAACAGGG + Intronic
1116184830 14:41585632-41585654 ATTTTTTAAACTATAGAACAGGG + Intergenic
1118025561 14:61764528-61764550 ATTTCCTCATCTATAAAACAAGG - Intronic
1118335612 14:64851319-64851341 ATTTCTTCACCTATAAAACAAGG + Intronic
1119710228 14:76816771-76816793 ATTTCTTTCCCTATCCAACATGG + Intronic
1120558936 14:85966707-85966729 ATTTATTCATCTATTCAACATGG + Intergenic
1121022341 14:90587904-90587926 GTTTCTTCACCTATGGAATGGGG + Intronic
1121127360 14:91417072-91417094 ATTTCTTCCGCTCTGGAACGCGG - Intronic
1122595740 14:102889755-102889777 CTTTCGTCACCCATGCAACAGGG - Intronic
1125203453 15:37123473-37123495 ATTTCCTCATCTAGGAAACAGGG - Intergenic
1126681530 15:51206883-51206905 GTTTCTTCATCTATGAAATATGG - Intergenic
1127215236 15:56816905-56816927 ACTTCCTCATCTATGGAATAAGG - Intronic
1128240950 15:66100545-66100567 TTTTTTTCACCTGTGAAACATGG + Intronic
1128855454 15:71008921-71008943 ATGTATTCACCTATGGTACCTGG + Intronic
1129957596 15:79653701-79653723 GTTTCTTCACCTATGGAGCAGGG - Intergenic
1130414118 15:83674109-83674131 ATTTTTTCACTTATAGATCATGG + Intronic
1131258649 15:90877250-90877272 CTTTCTTCCACTAAGGAACAGGG + Intronic
1131995477 15:98128720-98128742 ATTTCTTCATCTATAAAACGGGG + Intergenic
1133454280 16:5929562-5929584 ATAACTACACATATGGAACATGG - Intergenic
1134350501 16:13433501-13433523 CTTTCTTCACCCATGAAATAAGG - Intergenic
1135939416 16:26808408-26808430 ATTTCTGCACCTAGAGATCAGGG + Intergenic
1135964416 16:27023984-27024006 AGTTCTTCAGCTTTGGAACTCGG + Intergenic
1137748122 16:50838269-50838291 ATTTCCTCACCTGTGAAACAGGG - Intergenic
1139145946 16:64325886-64325908 GTTTCTCCATCTATGAAACAAGG + Intergenic
1139168259 16:64597397-64597419 ATTTGTTCACCTGTGTTACATGG - Intergenic
1141249135 16:82338978-82339000 TTATCTTCACTTATGGAACCTGG + Intergenic
1141319877 16:82997640-82997662 GTATTTTCACCTATAGAACAGGG - Intronic
1141339686 16:83191663-83191685 AGTTCTTCAGCTTTGGAACTTGG - Intronic
1143238632 17:5424675-5424697 GTTTCTTCACCTTTGAAATAAGG + Intronic
1143254735 17:5547482-5547504 ATTTCTTTATATATGGAAAATGG + Intronic
1143891295 17:10104451-10104473 ATGTCTGAAGCTATGGAACAGGG - Intronic
1144488953 17:15691427-15691449 ATTCCTCCCCCTGTGGAACAAGG + Intergenic
1144912069 17:18690877-18690899 ATTCCTCCCCCTGTGGAACAAGG - Intergenic
1145758019 17:27407058-27407080 ATTTCCTCACCTGTGGAATAAGG + Intergenic
1146569797 17:33942388-33942410 ATTTCTTCATCTGTGAAATAAGG - Intronic
1148414764 17:47497950-47497972 TTTTCCTCACCTATGGAAAGGGG + Intergenic
1148525412 17:48328150-48328172 GTTTCCTCACCTATCAAACAAGG + Intronic
1148757529 17:49981420-49981442 ATTTCTTCACCTATGCAGTAGGG + Intergenic
1149252607 17:54787755-54787777 GTTTCTTCACCTATTAACCAGGG - Intergenic
1149618337 17:58021191-58021213 ATTTCTTCACCTATAAAATGGGG + Intergenic
1149686145 17:58536199-58536221 ATTTCTTCATCTGTGAAATAGGG + Intronic
1151131720 17:71904021-71904043 ATTGCTTCAACTCTGGAATAGGG - Intergenic
1151729089 17:75900404-75900426 ATTTCTTCACCTGTAAAACTGGG - Intronic
1203168831 17_GL000205v2_random:127062-127084 AGTTCTTCAGCTTTGGGACATGG + Intergenic
1153853040 18:9114581-9114603 ATTTCTGTACCTATAAAACAGGG - Intronic
1155595910 18:27487015-27487037 GTTTCTTCATCTATGAAAAATGG + Intergenic
1156072891 18:33235094-33235116 ATTTGTTCACCTCTGAGACAAGG - Intronic
1156179936 18:34591371-34591393 ATATCTTAACCTATGGAAAATGG - Intronic
1156809399 18:41228308-41228330 ATTTCTGCACATCTGAAACATGG + Intergenic
1157196667 18:45625456-45625478 ATTTCTTCACCTTTGTGCCATGG - Intronic
1157803678 18:50642303-50642325 AATTCTTCAGCTCTGGAGCATGG - Intronic
1164689244 19:30197061-30197083 ATTTCTTCAGCTTTGGTACTCGG - Intergenic
1166738113 19:45098002-45098024 GTTTCCTCACCTGTGAAACAGGG + Intronic
925113415 2:1354987-1355009 ATTTCTTCATGTGTGAAACAGGG + Intronic
925517166 2:4695725-4695747 ATTTCTTCACCTGTGGAATGGGG - Intergenic
925785327 2:7426713-7426735 ATTTCTTCATTTATAAAACAAGG + Intergenic
925858861 2:8156019-8156041 ATGTCTTCACCTGTGAAACGGGG - Intergenic
926079250 2:9970705-9970727 TTTTCTTCCCCCAGGGAACAAGG - Intronic
927390120 2:22585423-22585445 ATTTCTTCTACTACAGAACAAGG + Intergenic
927408239 2:22796620-22796642 ATTTCTTCACCTATAAAATCAGG - Intergenic
927439810 2:23105520-23105542 ATTTCTTCATCTATGTCAAATGG + Intergenic
928201229 2:29248986-29249008 ATTTCTCCACCCATGGGCCAGGG + Intronic
928400962 2:30978425-30978447 ATTTCTTCATCTCTAAAACAAGG + Intronic
928611435 2:32995900-32995922 ATTTCCTCATCTATAAAACAGGG - Intronic
929289906 2:40178267-40178289 ATCCCTCCACCTATGTAACAGGG - Intronic
930562048 2:52972210-52972232 GTTTCTTCCTCTATGAAACAGGG - Intergenic
931147321 2:59533560-59533582 ATTTCTTCACTTCTGTAAAATGG - Intergenic
931465398 2:62482395-62482417 ATTTCCTCACCTGTCAAACAGGG - Intergenic
931511033 2:62994453-62994475 ATTTCTTCACTTAATTAACAGGG + Intronic
932659763 2:73641923-73641945 ATTTCTTCAACTATAGAACAGGG + Intronic
932666329 2:73701601-73701623 ACTTCTTCATCTATAGAACAGGG + Intergenic
932668600 2:73718001-73718023 ACTTCTTCATCTATAGAACAGGG + Intergenic
933002199 2:76939448-76939470 ATTTTTTCACCAATGGAATGTGG - Intronic
933087975 2:78079975-78079997 ACATTTTCACCTCTGGAACATGG - Intergenic
933573824 2:84044221-84044243 GTTTCTTCTCCTATGGAATAAGG - Intergenic
933632592 2:84674192-84674214 ATTTCTTGATCTATAAAACAGGG - Intronic
934121769 2:88847240-88847262 GTTTCTTCATCTATGAGACAGGG + Intergenic
936844539 2:116814998-116815020 ATTTTTTCACTTGTGTAACAAGG + Intergenic
938623648 2:133084472-133084494 ATTTCCTCACCTGTAAAACATGG + Intronic
938686650 2:133744341-133744363 ATTTCTTCAACTGTAGAATAGGG - Intergenic
939086088 2:137720192-137720214 AATTCTTCAGCTTTGGAACTCGG + Intergenic
939200801 2:139031490-139031512 ATTGCTTCAGCTCTGGCACAGGG + Intergenic
939935185 2:148283081-148283103 ATTTCTTCATTTATATAACAGGG + Intronic
940324989 2:152415812-152415834 GTTTCTTCACCAAAGGGACATGG + Intronic
941641030 2:167988616-167988638 AAGCCTTCACCTATGGAAGAAGG - Intronic
942354906 2:175100190-175100212 ATTTCTTTACCTATAAAACTGGG + Intronic
942777640 2:179603225-179603247 ATTTCCTCACCTATGAAGTAAGG + Intronic
943008434 2:182416071-182416093 ATTTCTTCATCTATGAAATGGGG + Intronic
943520799 2:188946588-188946610 ATTTCCTCACTTATGAAACTGGG + Intergenic
944969494 2:204976370-204976392 GTTTCCTCACCTATAAAACAAGG + Intronic
945512278 2:210717335-210717357 ATTTTTTTTCCTATGGCACAAGG - Intergenic
945929218 2:215838458-215838480 ATCTCTTCACCTAGATAACATGG - Intergenic
947478496 2:230474151-230474173 ATTTCCTCATTTATGAAACAGGG - Intronic
1169008515 20:2230047-2230069 TTTTCCTCACCTATGAAATAGGG - Intergenic
1169522983 20:6393079-6393101 AGTTCTTCACCTTTGGGACTTGG - Intergenic
1169563191 20:6824322-6824344 AGTTCTCCACCTATAAAACAAGG - Intergenic
1172037475 20:32019836-32019858 GTTACTTCACCTATGGATCTCGG - Intronic
1172503872 20:35446666-35446688 ATTTCCTCATTTATGAAACAAGG - Intronic
1172700198 20:36848584-36848606 AGTTCTTCATCTGTAGAACATGG - Intronic
1172745958 20:37209136-37209158 GTTTCTTCACCTGTGCAATAAGG + Intronic
1174279636 20:49429788-49429810 ATTTCTTCACCTGGATAACAAGG - Intronic
1175448121 20:59040392-59040414 ACTTCTTCACCTTTGAAACGAGG + Intronic
1176402925 21:6332089-6332111 AGTTCTTCAGCTTTGGGACATGG - Intergenic
1176434232 21:6657015-6657037 AGTTCTTCAGCTTTGGGACATGG + Intergenic
1177284254 21:19028031-19028053 ATTTCTTCATATATTGAACTAGG + Intergenic
1177458663 21:21379911-21379933 AGTTCTTCAGCTATGGGACTCGG - Intronic
1178908665 21:36656469-36656491 ATCTCTTCAACTATAAAACAGGG + Intergenic
1179348201 21:40581399-40581421 ATTTCTTCGCCTGTAAAACAGGG - Intronic
1181757191 22:25032307-25032329 GTTTCTTCATCTATAAAACAGGG - Intronic
1182577688 22:31284208-31284230 GTTTCTTCATCTATAAAACAGGG - Intronic
1183780844 22:39997947-39997969 GTTTCCTCACCTGTGAAACAGGG - Intronic
1184530233 22:45050959-45050981 GTTTCTTCACCTGTAAAACAGGG + Intergenic
949189453 3:1234087-1234109 ATGTCTTCACCTGTAAAACATGG - Intronic
949534042 3:4981849-4981871 ATTTCTTCTCCAATGAAAGAGGG - Intronic
949659145 3:6257026-6257048 AGTTCTTCAGCTCTGGAACTCGG + Intergenic
949965529 3:9352789-9352811 ATTTCATCACCTGTATAACACGG + Intronic
951256868 3:20460045-20460067 ATTTCTTCAACTATGGAATGAGG - Intergenic
952038399 3:29232426-29232448 ATTTCCTCATCTGTGAAACAGGG - Intergenic
952713544 3:36455230-36455252 ATTTCTTCCTGGATGGAACAGGG - Intronic
952723865 3:36561377-36561399 AGTTCTTCACCTGTGAAACGAGG - Intergenic
953557057 3:43954207-43954229 ATTTCTCCACCCCTGGAATATGG - Intergenic
955966777 3:64397000-64397022 TTTTCTTGACCCATGGAACATGG - Intronic
957162593 3:76629440-76629462 AGTTCTTCAGCTTTGGAACTTGG - Intronic
957230551 3:77508868-77508890 GTTTCTTCATCTAGGCAACAGGG + Intronic
957282838 3:78175501-78175523 ATTGCTGCACCAATGGAGCAAGG + Intergenic
957312131 3:78534203-78534225 CTTTCTTCACCTCTAGAACTGGG - Intergenic
957385092 3:79486093-79486115 GTTTCTTCATCTATAAAACAAGG + Intronic
959517224 3:107282007-107282029 ATTTCCTCATCTGTGGAATAAGG - Intergenic
960097910 3:113705723-113705745 ATTTTTTCACTTATAGAGCATGG + Intergenic
960142622 3:114165808-114165830 ATTTCTCCATCTATGAAATAGGG + Intronic
960235395 3:115275962-115275984 ATTTATTCAGCTATGGATAAAGG + Intergenic
960698475 3:120418263-120418285 ATTTCCTCATCTATGGAATAGGG - Intronic
961866119 3:129954639-129954661 ATTTCCACACCTCTGGCACAAGG + Intergenic
962555463 3:136546310-136546332 GTTTCTTGACCTGTGGCACATGG + Intronic
963403377 3:144831745-144831767 ATTTCTTCAGCTATAAAATAAGG + Intergenic
963408519 3:144900457-144900479 ATATTTACACCTATGGTACATGG + Intergenic
964123717 3:153213938-153213960 GTTTCTTCACCTGTGAAATAAGG + Intergenic
964363346 3:155921878-155921900 GTTTCTTCATCTATAAAACAGGG - Intronic
964580903 3:158236695-158236717 ATTTATTCTCCTATTGAAGATGG + Intronic
969930543 4:10626913-10626935 GTTTCTTCACCTGTAAAACAGGG + Intronic
970032496 4:11692631-11692653 ATTTCTTGACCAATAGAATATGG + Intergenic
970472249 4:16390511-16390533 ATTTCTTCATCTATTAAATAGGG - Intergenic
970490710 4:16570911-16570933 ATTTCCTCACCAATAAAACAGGG - Intronic
970503708 4:16705326-16705348 ATTTTTTCACCTATTGAAGTTGG + Intronic
970730412 4:19096874-19096896 ATTTCTTCAAATATGGTCCAGGG + Intergenic
970782503 4:19755350-19755372 GTTTCTTCACCTATGAAACAGGG + Intergenic
971375455 4:26052368-26052390 TTTTCCACACCTATAGAACAGGG - Intergenic
971724167 4:30287536-30287558 TTCTAATCACCTATGGAACAGGG + Intergenic
971978991 4:33730393-33730415 AGTTCTTCAGCTTTGGAACTTGG - Intergenic
972121686 4:35711514-35711536 AGTTCTTCAGCTTTGGAACTTGG - Intergenic
972211980 4:36849502-36849524 ATTTCTTTATCTGTGGGACATGG - Intergenic
973224917 4:47772842-47772864 ATTTTCTTACCTATGTAACATGG - Intronic
975038405 4:69712706-69712728 CTGGCTTCTCCTATGGAACATGG - Intergenic
975327171 4:73071544-73071566 ATTTCTTAATCTATATAACAGGG + Intergenic
975523043 4:75320578-75320600 AATGTTTCACCTAGGGAACAGGG - Intergenic
976595725 4:86893027-86893049 ATTTCTTCATCTATAAAACAAGG + Intronic
977511865 4:97972145-97972167 TTTCCTTAACATATGGAACATGG + Intronic
978651438 4:111010203-111010225 GTTTCTTTCTCTATGGAACATGG + Intergenic
979002618 4:115243797-115243819 AGTTCTTCAAGTATGGAACAAGG + Intergenic
979230478 4:118343437-118343459 TTTCCTTCACATATGGAATATGG - Intronic
979738030 4:124112913-124112935 CTTTCTTCTCCCATGGAAAAGGG + Intergenic
979843415 4:125475894-125475916 CTTTTTTCACCTATAAAACAGGG + Intronic
981674995 4:147332549-147332571 ATTTCTACACCTCTGAACCAGGG + Intergenic
982171735 4:152668519-152668541 AGCTCTTCACCTATGGAATGGGG - Intronic
983080050 4:163373633-163373655 GTATCTTCACCTATTAAACAGGG + Intergenic
983152615 4:164303219-164303241 ATCTTATGACCTATGGAACATGG + Intronic
984672236 4:182503743-182503765 TTGTCTTGACCTATGGAATATGG - Intronic
984812191 4:183805300-183805322 ATGTCTACAGCTATGCAACAAGG - Intergenic
986546933 5:8907917-8907939 ATTTCCTCATCTATGGAATGAGG + Intergenic
987622213 5:20349118-20349140 ATTCCTTTAGTTATGGAACAAGG - Intronic
987713176 5:21530968-21530990 ATTTCTTCACATATTCAAAAGGG - Intergenic
988688436 5:33548381-33548403 ATTTCTTCCCCTATAAAATAGGG + Intronic
990806829 5:59672555-59672577 AATTCATCACCTAAGAAACATGG + Intronic
991007603 5:61845245-61845267 TTCTCTTCAACTATGTAACAAGG - Intergenic
991185533 5:63802239-63802261 ATTTCTTCATCAATGAAACTGGG + Intergenic
992123287 5:73615956-73615978 ATTTATTAAACTATGAAACATGG + Intergenic
992348251 5:75902416-75902438 ATTTCTCCATCTATAGAACAAGG + Intergenic
992527299 5:77624452-77624474 ATTTCTTCCTCTATACAACAAGG + Intergenic
992560988 5:77952593-77952615 ATTTATTCAATTATGGAACCGGG + Intergenic
993183112 5:84580749-84580771 ATTTCTTGAGATATGGAACTGGG - Intergenic
993632206 5:90300124-90300146 ATTTCTCCACATGTTGAACATGG - Intergenic
993862586 5:93154212-93154234 ACTTTGTGACCTATGGAACATGG - Intergenic
995021829 5:107375425-107375447 ATTTCTTCCCCTAAGGAAGTAGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995544459 5:113216012-113216034 GTTTCCTGACCTCTGGAACAGGG - Intronic
995575356 5:113525495-113525517 GTTTCTTCACCTGTGAAATAGGG - Intronic
996842702 5:127865194-127865216 GTCTCTCCACCTATGAAACATGG + Intergenic
997068952 5:130596185-130596207 AATTCTTCAGCTTTGGAACACGG + Intergenic
997904712 5:137804935-137804957 ATTTCATCACCCAGGTAACAAGG + Intergenic
998740989 5:145201476-145201498 ATTTCTTCATCTGTAAAACAAGG + Intergenic
999664377 5:153897500-153897522 ATTTCCTCATCTATGAAACAAGG + Intergenic
999985623 5:157002385-157002407 ATTTCTTCACCTATGGAATCTGG + Intergenic
1000349619 5:160343140-160343162 ATTTCTTCATCTGTGGAAAGTGG + Intronic
1001527527 5:172439402-172439424 ATTTCTTCACACCTGGAAAATGG + Intronic
1001942955 5:175753642-175753664 GTTTCTTCATCTGTGAAACAAGG + Intergenic
1002761852 6:208678-208700 ATTTCCACACCTGTGCAACAGGG - Intergenic
1002948297 6:1783620-1783642 ATGGCTTCTCCTAAGGAACAAGG - Intronic
1002974415 6:2060134-2060156 AGTTTTTCACCTATCAAACATGG - Intronic
1003695553 6:8403524-8403546 AGTTCTTCACTTTTGGAACTTGG - Intergenic
1003866083 6:10364033-10364055 ATTTCTCCACCTCTGGCAGAGGG - Intergenic
1004802542 6:19166269-19166291 ATTTCTCCAGATTTGGAACAAGG + Intergenic
1006181593 6:32156570-32156592 ATTCATTCACATATGGTACATGG - Intronic
1008246441 6:49179705-49179727 TTTTCCTCATATATGGAACATGG - Intergenic
1008573036 6:52833092-52833114 ATTTCTGCACCCATGCAATAAGG - Intronic
1008927652 6:56904004-56904026 ATTTCCTCACCTATAAAATAAGG + Intronic
1009003548 6:57750934-57750956 ATTTCTTCACATATTCAAAAGGG + Intergenic
1009058172 6:58364438-58364460 ATTTCTTCTCATATAAAACAAGG - Intergenic
1009232653 6:61082675-61082697 ATTTCTTCTCATATAAAACAAGG + Intergenic
1009588130 6:65632822-65632844 ATTTCTTCACCTATGGAACATGG - Intronic
1011068603 6:83357798-83357820 AGTTCTTCAGCTTTGGAACTCGG + Intronic
1011513151 6:88123587-88123609 GTTTCTTCAACTGTGAAACAGGG + Intergenic
1011638575 6:89398751-89398773 ATTTCTTCACCTGTGAAATGGGG - Intronic
1011754420 6:90484166-90484188 TTTTCCTCACCCATGGAACGAGG + Intergenic
1012039942 6:94191104-94191126 AGTTCTTCACTTTTGGAACTTGG + Intergenic
1012219565 6:96632098-96632120 ATGTGGTCACCTATGGAAGAAGG - Intergenic
1012936448 6:105372862-105372884 ATTTCTCCACCCATTGAAAAGGG + Intronic
1013624747 6:111925940-111925962 ATTTCTTCACCTATAAAGTAAGG + Intergenic
1014975945 6:127884242-127884264 ATTTCTTCCCATGTGGCACATGG + Intronic
1015173947 6:130286066-130286088 ATTTCTTCATTTATAAAACATGG - Intronic
1015410041 6:132883925-132883947 ATTTCTTTATCTATAAAACAGGG - Intergenic
1016063409 6:139654147-139654169 ATTTATTCTTCTATGGAGCAAGG + Intergenic
1016268283 6:142257693-142257715 ATTTCCTGGCCTATGCAACATGG + Intergenic
1016731145 6:147429441-147429463 ATTTCTTCAGCTATAAAATAAGG + Intergenic
1017944348 6:159081521-159081543 ATTTCCTCACCTATGAAATACGG - Intergenic
1017970738 6:159310548-159310570 AGTTCTTCAGCTTTGGAACATGG + Intergenic
1017977546 6:159371480-159371502 AGTTCTTCACCTTTGGAACTGGG - Intergenic
1018058075 6:160069437-160069459 AGTTCTTCACCCAGGGCACATGG + Intronic
1018666164 6:166140478-166140500 ATTTCGTCTCCTCTGGAACATGG + Intergenic
1018885370 6:167930891-167930913 ATTTTTACAACTCTGGAACATGG + Intronic
1020370587 7:7428054-7428076 ATTTCTTCATCTATAAAACAGGG + Intronic
1020603827 7:10309847-10309869 ATTTCTGCAACTTTGGAATAGGG - Intergenic
1021680888 7:23130287-23130309 ATTTCTAGCCCTGTGGAACATGG + Intronic
1021934935 7:25620925-25620947 ATTTCCTCATCTGTAGAACAGGG + Intergenic
1022218394 7:28288003-28288025 GTTTCTTCACCTGTGGAATGGGG + Intergenic
1023535271 7:41202271-41202293 ATTACTTCTCCTTTGAAACAGGG - Intergenic
1024884031 7:54122010-54122032 AGTTCTTCAGCTTTGGAACTCGG - Intergenic
1027980452 7:85213612-85213634 ATTTCTTCACAGATGGATAAAGG + Intergenic
1028981979 7:96977363-96977385 ATTTATTCACATATGGAAGGTGG + Intergenic
1029590756 7:101505552-101505574 AGTTCTTCAGCTTTGGAACTCGG - Intronic
1029607424 7:101607337-101607359 AGTTCTTCAGCTTTGGAACTTGG + Intergenic
1029820986 7:103146876-103146898 TTTTCCTCATCTGTGGAACAAGG + Intronic
1030624922 7:111833775-111833797 ATTTCTTCCCCTAAGGCACTGGG + Intronic
1030927710 7:115477984-115478006 ATTTCTTCCTCAATGGAACAAGG - Intergenic
1031181536 7:118423995-118424017 ATTTTTTCCCCCATTGAACAAGG + Intergenic
1031474121 7:122202716-122202738 AATTCTTCAGCTTTGGAACTTGG - Intergenic
1031481807 7:122287192-122287214 AGTTCTTCACCTTTGGGACTCGG - Intergenic
1031561987 7:123249755-123249777 ATTTCTTCATCTATGAAATGGGG + Intergenic
1034476927 7:151290494-151290516 GTGTCATCACCTATGGAATAAGG - Intergenic
1034586055 7:152093295-152093317 ATTCCCTCACCTATAAAACAAGG - Intronic
1034738767 7:153453991-153454013 CTTTCCTCACCTAGGGAAGATGG + Intergenic
1035843362 8:2836315-2836337 ATTTCTTCAATTATGAAACCAGG + Intergenic
1036496964 8:9278396-9278418 ATTTCTTCACCTGTAAAATAAGG + Intergenic
1036583577 8:10101200-10101222 ATTTCTTCATCTGCAGAACAGGG + Intronic
1037517835 8:19651355-19651377 ATTTCGTCACCAAGGTAACAAGG + Intronic
1037567843 8:20132535-20132557 GTGTCTTCATCTATGAAACAGGG - Intergenic
1037772328 8:21809831-21809853 AGTTCTTTAGCTATAGAACACGG + Intronic
1038665401 8:29532949-29532971 AGTTCTTCAGCTTTGGAACTTGG + Intergenic
1039082718 8:33748894-33748916 ATTTCTTCATCTTTATAACAAGG - Intergenic
1039335325 8:36582750-36582772 ATTTCTTCAGCAAGGGAACCTGG - Intergenic
1040850311 8:51894514-51894536 ATTTCTTCACCTGTAGAATGGGG + Intronic
1041082542 8:54227174-54227196 CTTCCTCCACCTATGGAATAGGG - Intergenic
1041902962 8:63002097-63002119 ATTTATTCACCTAAGGATTATGG + Intergenic
1042000729 8:64121361-64121383 AGTTCTTCAGTTTTGGAACATGG - Intergenic
1042478487 8:69277407-69277429 AGTTCTTCATCTACAGAACAAGG + Intergenic
1042681113 8:71385612-71385634 ATTTCTTCATCTGTAGAACAGGG - Intergenic
1043188790 8:77190366-77190388 ATTTCTTCAGTTTTGGAACTAGG + Intergenic
1044285215 8:90403457-90403479 ATTTCTTCAACTATGGAAGGTGG - Intergenic
1045655158 8:104379080-104379102 ATTTCTTCTCCTAGGTAACTAGG - Intronic
1046297237 8:112235679-112235701 AATTGTTCACCTATGTAATAGGG + Intronic
1046540930 8:115581638-115581660 ACTTCTATACCTATGGAATATGG + Intronic
1047031789 8:120889974-120889996 ATTTATTCATTTATGTAACATGG + Intergenic
1049112053 8:140652591-140652613 GTTTCTTCACCTGTGAACCAGGG + Intergenic
1049240331 8:141534637-141534659 CTGTCTTCTCCTCTGGAACATGG + Intergenic
1052439228 9:28472214-28472236 ATTGCTTAACCTATGATACATGG + Intronic
1052533362 9:29716927-29716949 ATTTCATCAACTATAGAAAATGG + Intergenic
1053533352 9:38903472-38903494 GTTTCTTCATCTGTAGAACAGGG + Intergenic
1053836244 9:42138301-42138323 TTTTATTCACCTATGGAACATGG + Intergenic
1054126858 9:61321660-61321682 TTTTATTCACCTATGGAACATGG - Intergenic
1054205578 9:62127901-62127923 GTTTCTTCATCTGTAGAACAGGG + Intergenic
1054594374 9:67050222-67050244 TTTTATTCACCTATGGAACATGG - Intergenic
1054632783 9:67460469-67460491 GTTTCTTCATCTGTAGAACAGGG - Intergenic
1055585581 9:77756125-77756147 AATTCTTCAGCTTTGGAACTCGG + Intronic
1056109651 9:83382461-83382483 ATTTCTTCATCTATTAAATAAGG - Intronic
1056168351 9:83959467-83959489 AGTTCTTCACCTACTGAACATGG + Intergenic
1057097676 9:92326617-92326639 GTTTCTTCAACTATAAAACAGGG - Intronic
1057754058 9:97817079-97817101 GTTTCTTCACCTGTGAAAAAGGG + Intergenic
1058100621 9:100914821-100914843 ATTTCTCCATCTATGGGACATGG + Intergenic
1059929272 9:119244871-119244893 TTTTCTTCACCTCTGAAACAAGG - Intronic
1060830037 9:126708002-126708024 GTGTCTTCATCTATGGAATAGGG - Intergenic
1060881464 9:127121099-127121121 GTTTCCTCACCTATAAAACAGGG + Intronic
1060915319 9:127385532-127385554 AATTCTTAGCCTATGAAACATGG + Intronic
1062105582 9:134753156-134753178 TTATCTTCAACTCTGGAACAGGG - Intronic
1203437304 Un_GL000195v1:151635-151657 AGTTCTTCAGCTTTGGGACATGG - Intergenic
1186274133 X:7921681-7921703 ATTTCTTCAAATAGGAAACATGG + Intronic
1186335431 X:8581987-8582009 ATTTCCTCATATATTGAACAAGG + Intronic
1186483594 X:9915085-9915107 ATTTCTTCATCCATAAAACAAGG + Intronic
1187921053 X:24202366-24202388 ATTTCTTCAAGTATGTAAAAAGG - Intronic
1188610812 X:32095117-32095139 GTTTCTTCACCTCTGGAAGGAGG - Intronic
1188867112 X:35326827-35326849 ATTTGTTGACTCATGGAACATGG - Intergenic
1189175454 X:38952527-38952549 GTTTCTTCATCTATGGAATGGGG + Intergenic
1190481055 X:50877342-50877364 ATTTCCTCATCTATAAAACAAGG - Intergenic
1192089937 X:68143441-68143463 ATTTCTTCATCTTTGGGAAACGG + Intronic
1192183890 X:68933142-68933164 GTTTCCTCACCTATCAAACAGGG + Intergenic
1192797430 X:74435603-74435625 ATTTCTTCCCCCATAGAACATGG - Intronic
1193131199 X:77921535-77921557 ATTTTTTCATCTATGAAACAGGG + Intronic
1193396628 X:80991141-80991163 ATTCCTTTACCTGTGGAAAAAGG + Intergenic
1194052436 X:89087854-89087876 AGTTCTTCAGTTATGGAACTCGG + Intergenic
1195894895 X:109735494-109735516 ATTTCTTCATCTGTGAAATAGGG - Intergenic
1196100166 X:111839328-111839350 ATTTGTGCATTTATGGAACAAGG - Intronic
1196306092 X:114104947-114104969 GTTTCCTCATCTATGAAACAGGG - Intergenic
1196330238 X:114464244-114464266 ATTTCTTTATCTATGAAACAGGG - Intergenic
1197426164 X:126299066-126299088 AGTTCTTCACTTTTGGAACTTGG - Intergenic
1198695479 X:139332327-139332349 ATTTCTTCTCCTATAGAAAGGGG + Intergenic
1199160765 X:144608309-144608331 ATTTCTTTTCTTATGGAAAAAGG - Intergenic
1199858424 X:151778907-151778929 ATTTCTTCCCATATGGAATGGGG + Intergenic
1201428118 Y:13876306-13876328 ATTTCCTCATATATTGAACAAGG - Intergenic