ID: 1009588322

View in Genome Browser
Species Human (GRCh38)
Location 6:65635393-65635415
Sequence AGGGAAAGGCAAGATGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 893
Summary {0: 1, 1: 4, 2: 14, 3: 89, 4: 785}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009588322_1009588330 -3 Left 1009588322 6:65635393-65635415 CCCGCCCCATCTTGCCTTTCCCT 0: 1
1: 4
2: 14
3: 89
4: 785
Right 1009588330 6:65635413-65635435 CCTTCAACATTCCTGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009588322 Original CRISPR AGGGAAAGGCAAGATGGGGC GGG (reversed) Intronic
900424902 1:2572620-2572642 AGGGAAAGGCAAGTGTGTGCTGG + Intergenic
900657475 1:3766676-3766698 AGCAAAGGGCAAGACGGGGCTGG + Intronic
901428065 1:9196085-9196107 AGGGAAAGGCTGGAGGGGGAAGG + Intergenic
901493313 1:9607592-9607614 AGGGATGGCCAAGCTGGGGCTGG - Exonic
901776421 1:11563377-11563399 AGGGACAAGGAAGGTGGGGCAGG + Intergenic
902131974 1:14269750-14269772 AAGCAAAGGGAAGGTGGGGCAGG + Intergenic
902547424 1:17198808-17198830 TGGGAAAAGCCAGCTGGGGCAGG + Intergenic
902651427 1:17840023-17840045 AGGGAAGGGCAAGCTGGTTCCGG + Intergenic
902668297 1:17954468-17954490 AGGGAATGGCAAGATGGGGCAGG - Intergenic
902690926 1:18109755-18109777 AGGGAAAGGTTACATGGGGGAGG + Intronic
902817110 1:18922702-18922724 AGAGAAAGCTAAGAGGGGGCAGG + Intronic
902930626 1:19728769-19728791 ATGGAAAGGCAGAGTGGGGCAGG - Intronic
903053475 1:20618763-20618785 AAGGAAAGGAAAGGTGGGGCAGG - Exonic
903295440 1:22340441-22340463 AGGGATGGGCAAGGAGGGGCAGG + Intergenic
903495070 1:23760436-23760458 AGGGGAAGGAAAGATAGGGAAGG - Exonic
903519589 1:23936590-23936612 AGGGAAAGGCAAGATGGGTGTGG - Intergenic
903629684 1:24758053-24758075 AGAGAAAGGCTAAATAGGGCTGG - Intronic
903805706 1:26004233-26004255 AGGGAAAGGAAGGGTGGGGAAGG - Intergenic
903841561 1:26245401-26245423 TAGGAAAGGCAAGAGGAGGCAGG - Intronic
903976695 1:27154806-27154828 AGGAAAAGGAGAGAGGGGGCTGG + Exonic
904259224 1:29278984-29279006 AGGGAAAGGCAGCAGGGGCCAGG - Intronic
904377710 1:30092196-30092218 AGGGAAGGGCAAGAAGGTGTGGG - Intergenic
904400609 1:30254158-30254180 CAGGAAGGGCAAGATGAGGCCGG - Intergenic
904783321 1:32966613-32966635 AAGGAATGGTAAGATGGGCCAGG + Intergenic
904833122 1:33318383-33318405 AGTGAATGGCAGGATGGGGGAGG - Intronic
904919145 1:33993214-33993236 AGGGGAAGGCAGGAGAGGGCTGG + Intronic
905164595 1:36071577-36071599 AGGGGAAGGGAAGATGAGGAGGG - Exonic
906215562 1:44036192-44036214 GGGGAAAGGCCAGCTGGGGCTGG + Intergenic
906281382 1:44556529-44556551 AGGAAAAGGCAAGAGAGGGAAGG - Intronic
906316807 1:44791729-44791751 AGGATAAGGAAAGGTGGGGCAGG - Intergenic
907275791 1:53315951-53315973 AGGGCAAGGCATGGTGGGGGAGG + Intronic
907390699 1:54156342-54156364 AGGGGAAAGGAAGTTGGGGCAGG - Intronic
907399739 1:54217530-54217552 CAGGAAGGGCAAGATCGGGCTGG - Intronic
907490497 1:54806120-54806142 AGGGAAAGCCAGGATGCCGCCGG + Exonic
908089205 1:60668878-60668900 AGGGAAAGGCACCCTCGGGCCGG + Intergenic
908248692 1:62248096-62248118 GGGGAAAGTCAGGCTGGGGCAGG - Intronic
908802869 1:67898123-67898145 TAGGAAAGGCATGAAGGGGCAGG - Intergenic
909161183 1:72150900-72150922 AGCAAAAGGCAAGATGAGTCAGG - Intronic
909931634 1:81504575-81504597 AGGGAAGGGCCAGAGGGGCCGGG - Intronic
910023500 1:82621819-82621841 ACGGAAAGGCAAGATGGAGGTGG + Intergenic
910194305 1:84624477-84624499 AGAATAAGGCAAGATGTGGCTGG - Intergenic
911175297 1:94811870-94811892 CAGGAAAGGCAAGATGGGGAAGG + Intergenic
912586987 1:110776161-110776183 TGGGAAAGGCAAGACGGTGGAGG - Intergenic
912994696 1:114521188-114521210 AGGAAAATGCAAGATGAGCCTGG + Intergenic
913092143 1:115483687-115483709 ACAGAAAGGCTAGATGGGGCTGG - Intergenic
913162342 1:116155622-116155644 TAGGAGAGGCAACATGGGGCAGG + Intergenic
913197686 1:116471628-116471650 AGGGAAGGGAAGGATGGAGCAGG - Intergenic
913354358 1:117901984-117902006 TGGGAAAGGCAAGGCAGGGCAGG - Intronic
913574394 1:120156157-120156179 AGAGAAAGTAAAGAAGGGGCAGG + Exonic
913575668 1:120171944-120171966 TAAGAAAGGCAAGATGAGGCTGG + Intronic
913718002 1:121558186-121558208 AGGGGAAGGGCAGATGGGGCAGG - Intergenic
914295664 1:146320964-146320986 AGAGAAAGTAAAGAAGGGGCAGG + Intergenic
914556704 1:148771745-148771767 AGAGAAAGTAAAGAAGGGGCAGG + Intergenic
914557982 1:148787514-148787536 TAAGAAAGGCAAGATGAGGCTGG + Intergenic
914614852 1:149342716-149342738 TAAGAAAGGCAAGATGAGGCTGG - Intergenic
914616130 1:149358485-149358507 AGAGAAAGTAAAGAAGGGGCAGG - Intergenic
914751528 1:150538115-150538137 AAGGAAATGCAAGTTGAGGCAGG - Intergenic
914777316 1:150749589-150749611 AGGGCAGGGCAAGGTGGGGCGGG - Intronic
914811307 1:151030396-151030418 AGGCAAAGGCAAAGGGGGGCGGG - Intronic
914921434 1:151850205-151850227 AGGGAGAGACAAGAGAGGGCAGG - Intronic
915205684 1:154268963-154268985 AGGGAAAGGAGAGAAGGGGAAGG - Intronic
915277820 1:154801698-154801720 AGGAAGAGGCAAGATGGTGGAGG + Intronic
915378216 1:155416826-155416848 AAGGAAAGGCAAGGTGGGGCTGG - Intronic
915465693 1:156096749-156096771 AGGGAAGGAGAAGGTGGGGCTGG + Intronic
915895396 1:159807911-159807933 AGGGAGAGGAAAGAAGGGGAGGG + Intronic
915935497 1:160088010-160088032 AGGGAAATGGAGGGTGGGGCCGG + Exonic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916302440 1:163291299-163291321 GGGTAAAGGCATGATGGGGTTGG - Intronic
916357125 1:163924230-163924252 AGGGAGAGACCAGATGGAGCAGG + Intergenic
917790084 1:178493824-178493846 AGGGAAAGACAGGCTGGGGTTGG - Intergenic
918706926 1:187675034-187675056 TGGGAAAGGCAAGTTTGGGGGGG - Intergenic
919380858 1:196859028-196859050 AGGAAAAGGCAACATGGCGCTGG - Intronic
919933389 1:202236061-202236083 AGGGAAGGGAAAGCTGAGGCAGG - Intronic
920213324 1:204344798-204344820 AAGGATTGGCAGGATGGGGCTGG - Intronic
920551451 1:206865162-206865184 AGGGAAAGGCAAGACGTGATGGG - Intergenic
920987744 1:210906337-210906359 AGGGGATGGCAAGATGCTGCTGG + Intronic
922061445 1:222096469-222096491 AAGGGAAGAGAAGATGGGGCGGG - Intergenic
922233343 1:223704950-223704972 AGGGAGCGGCAGGAGGGGGCTGG - Intronic
922360444 1:224816903-224816925 ATGGGAAGGCAAGATGTGGAAGG + Intergenic
922712177 1:227842539-227842561 GGTGGAAGGCCAGATGGGGCAGG - Intronic
923219537 1:231880742-231880764 AGAGCAAGGCAAGGTGGGGGGGG + Intronic
923353559 1:233131647-233131669 AGCGGGAGGCAAGATGGGCCAGG + Intronic
924421832 1:243917177-243917199 AGGGAAAAGCAAGACGGATCAGG - Intergenic
1063179412 10:3584330-3584352 AGGGACAGGCAGGAGGTGGCAGG - Intergenic
1063211049 10:3881629-3881651 AGGGAAAGGCAAGAGGGGTAGGG + Intergenic
1063298191 10:4826778-4826800 AGAGAAAGAAAAGTTGGGGCCGG + Intronic
1063365200 10:5486369-5486391 AGGGAGAGGGTAGCTGGGGCAGG + Intergenic
1063623327 10:7667537-7667559 AGGGACAGGAGAGGTGGGGCCGG - Intergenic
1064927135 10:20581851-20581873 AGGAAAAGGCAACATTGAGCAGG - Intergenic
1065169253 10:23010676-23010698 AGGGAAAGGAAGGAAGGGGGAGG - Intronic
1065169261 10:23010696-23010718 AGGGAAAGGAAGGAGGGGGAAGG - Intronic
1065169329 10:23010924-23010946 AGGGAAAGGAAGGAAGGGGGAGG - Intronic
1065421975 10:25555043-25555065 AGGAAAAGGAAAGAAGGGGAGGG + Intronic
1067190206 10:44062324-44062346 TGGGCATGGCAAGAAGGGGCCGG - Intergenic
1067394616 10:45903045-45903067 GGGGAGAAGAAAGATGGGGCAGG + Intergenic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1067774581 10:49153861-49153883 AGGGGAAGGTGAGATGGGACAGG - Intergenic
1067862939 10:49872176-49872198 GGGGAGAAGAAAGATGGGGCAGG + Intronic
1067912832 10:50364419-50364441 AGTGAAAAGCAGGATGGGGCTGG - Intronic
1067940567 10:50651482-50651504 GGGAAGAGGCATGATGGGGCAGG - Intergenic
1068915445 10:62426665-62426687 CGGGAAAGGCAAGGCTGGGCAGG + Intronic
1069176364 10:65293774-65293796 AAGGAAAGGGAAAATGAGGCAGG - Intergenic
1069498738 10:68930588-68930610 AGGGAAGTGTAAGATGAGGCTGG - Intronic
1069771459 10:70903209-70903231 AGGCAGAGGCAAGATTGGGCGGG + Intergenic
1070144365 10:73763108-73763130 CGGGGAAGGCATGATGGGGGAGG + Intronic
1070589916 10:77794381-77794403 ACAGAAAGGCAAAATGGAGCAGG + Intronic
1071276827 10:84063323-84063345 AGGCAGAGGCAAGATGGGGATGG - Intergenic
1071569055 10:86686499-86686521 TGGGAAAGCCAAGATGGGCAAGG + Intronic
1071662744 10:87521424-87521446 AGGGAAGGGCAAGAGGAGGCAGG - Intronic
1071794573 10:88990953-88990975 GGGGATAGGCAAAGTGGGGCGGG + Exonic
1071950070 10:90693136-90693158 AGGAACAGGCAACATGGTGCTGG - Intergenic
1072124785 10:92436030-92436052 AGGGAAAAGCAAGATCTGGGTGG - Intergenic
1072696727 10:97609441-97609463 AGGGTGAGGCAGGATGGGGTAGG - Intronic
1073091690 10:100946219-100946241 AGGGAAAGGAAATATAGGGTCGG - Intronic
1073208277 10:101780067-101780089 AGGGAGAGGGAAGTCGGGGCTGG - Intronic
1073495857 10:103890487-103890509 AGGGCAAGGCGTGGTGGGGCTGG - Intronic
1073583177 10:104685958-104685980 AGGGTCAGGCAAGAGGGAGCCGG - Intronic
1074292199 10:112146485-112146507 AGGGAAAGGCAGGGCAGGGCAGG - Intergenic
1074416241 10:113269346-113269368 AGGGGAAGGCAGGATTGAGCAGG + Intergenic
1074973322 10:118560914-118560936 AGGGAAAGGCAAGGCAAGGCAGG - Intergenic
1075213429 10:120511178-120511200 AGGAAGAGGCAAGTTGAGGCAGG + Intronic
1075443643 10:122498911-122498933 AAGGGAAGGTCAGATGGGGCTGG - Intronic
1075491634 10:122876288-122876310 ACGGGAAGGCTAGAGGGGGCTGG + Intronic
1075702827 10:124480148-124480170 AGGAAGAGGCAACCTGGGGCTGG + Intronic
1075816842 10:125271292-125271314 AGGGAAAGGCCCTATGGAGCAGG + Intergenic
1075936992 10:126351192-126351214 AGGGAAGGGCAGGGTGGGGTGGG - Intronic
1076137028 10:128052210-128052232 AGAGAAAAGAAAGATGGGGTTGG - Intronic
1076369789 10:129945039-129945061 AGGAAAAGGGAAGATGGGCGGGG + Intronic
1076446669 10:130518919-130518941 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446673 10:130518950-130518972 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446677 10:130518981-130519003 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446681 10:130519012-130519034 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446685 10:130519043-130519065 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446689 10:130519074-130519096 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446693 10:130519105-130519127 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446697 10:130519136-130519158 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446701 10:130519167-130519189 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446705 10:130519198-130519220 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446709 10:130519229-130519251 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446713 10:130519260-130519282 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446717 10:130519291-130519313 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076446721 10:130519322-130519344 AGGAGCAGGCAAGATGGCGCTGG + Intergenic
1076603532 10:131674722-131674744 AGGCACAGGCATGATGTGGCAGG - Intergenic
1077240146 11:1506540-1506562 AGGGGATGGGCAGATGGGGCAGG + Intergenic
1077315662 11:1918370-1918392 AGGGACAGGCAAGGTGTGCCTGG - Intergenic
1077442826 11:2576691-2576713 GGGGCAAGGCCAGAAGGGGCTGG + Intronic
1077915512 11:6609162-6609184 AGGGAAGGGCAAGAAGGGCAGGG - Intronic
1078083868 11:8222132-8222154 TGGGGTAGGCAAGGTGGGGCTGG + Intergenic
1078192121 11:9099805-9099827 AGGGAAAGAACAGATGGGGACGG - Intronic
1078320901 11:10333627-10333649 AGGGAAAGGCCATATGAGGACGG + Intronic
1078551902 11:12287050-12287072 AGGGACAGGGAAGATGGGGTGGG - Exonic
1078829907 11:14969175-14969197 AGGGAAGGGCTGGATGGGGAAGG + Intronic
1078941864 11:16015257-16015279 AGGGAAAGGAAAGCTGTGACAGG + Intronic
1079080553 11:17410687-17410709 AGGGAAAGGCATGGTGGGGAGGG + Intronic
1079096048 11:17510892-17510914 AGGGCAAGGCAGAATGGAGCAGG - Intronic
1079645008 11:22852224-22852246 GGTGAAAGGCAAGATGGAGTTGG - Intronic
1079973599 11:27065150-27065172 AGGGAAAGGCAAGATGGAGGAGG + Intronic
1080598998 11:33803731-33803753 GGGGAAAATCAAGATGGAGCAGG + Intergenic
1080723439 11:34871562-34871584 AGGAACAGGCAACATGGCGCCGG + Intronic
1080820654 11:35802952-35802974 AGGGAAAGGCAGGAGGAGGCAGG + Intronic
1080956527 11:37103173-37103195 ATGGAAAAGCTAGAGGGGGCTGG + Intergenic
1081092377 11:38888350-38888372 ATGGAGAGGCAAGAAGTGGCGGG - Intergenic
1081218341 11:40430001-40430023 AGGCAAAGCCAAGATGAAGCAGG - Intronic
1081529366 11:43947459-43947481 AAGGAGAGGCAGGCTGGGGCCGG + Intergenic
1081659133 11:44877215-44877237 AGGGTATGGCAGGCTGGGGCGGG + Intronic
1081714113 11:45236389-45236411 AGGGGAGGACAAGATGAGGCTGG - Intergenic
1081735615 11:45401448-45401470 AGGTAAGGGCCAGATAGGGCTGG - Intergenic
1081755600 11:45542143-45542165 AGGGTGAGGCAAGGTGGGGGAGG - Intergenic
1082258076 11:50054151-50054173 AGGGGAAGCCAGGGTGGGGCTGG + Intergenic
1082858279 11:57828899-57828921 AGGGTGAGGCAAGGTGGGGTTGG - Intergenic
1082941695 11:58711846-58711868 AGGGAAAGCCCCAATGGGGCAGG - Intronic
1083428658 11:62602414-62602436 AGGGAAGGGCAGGGCGGGGCGGG + Exonic
1083459102 11:62799096-62799118 AGAAAAAGGCAAGATGGGGCAGG + Intronic
1083663142 11:64261343-64261365 AGGGAATGGCCAGCTGTGGCGGG + Intronic
1084032911 11:66491647-66491669 AGGGGCAGGCAGGAGGGGGCAGG - Intronic
1084155021 11:67308484-67308506 AGGAGAAGGGAAGATGGGGTGGG - Intronic
1084399351 11:68934741-68934763 AGGGCGGGGCAAGGTGGGGCGGG - Intronic
1084425752 11:69083840-69083862 ACAGAAAGGCAAGATGGGGCAGG - Intronic
1084463324 11:69308263-69308285 CGGGAGAGGCAAGATGAGGTTGG - Intronic
1084510741 11:69602008-69602030 TGAGAGAGGCTAGATGGGGCAGG - Intergenic
1084892838 11:72244787-72244809 AGCGAAAGACAGGATGGAGCGGG + Intronic
1085028923 11:73257997-73258019 AGGCCAAGGGAAGATGGGCCTGG - Intergenic
1085220403 11:74869587-74869609 AGGGATGGGCAACATGGTGCAGG + Intronic
1085446552 11:76604677-76604699 AGAGGTAGGCAAGATGGGGGTGG - Intergenic
1085569732 11:77548892-77548914 TGGGGAAGGTAAGATGGAGCAGG + Intronic
1085794746 11:79528674-79528696 AGGAAAAGGCCAGATGGTACAGG + Intergenic
1086488714 11:87336902-87336924 AGCAACAGGCAAGAAGGGGCAGG - Intergenic
1086875241 11:92087922-92087944 AGGGAGAGGAAAGATGGAGAGGG - Intergenic
1087161098 11:94948863-94948885 AGTGAGAGGCAAGATGAGGCAGG - Intergenic
1087195549 11:95301062-95301084 AGGGTAAGGCAAGGTGGGAAGGG + Intergenic
1087327950 11:96746594-96746616 TGGGAAATGCAACATTGGGCAGG - Intergenic
1088454807 11:110022463-110022485 AAGGAAAGGGGAGATGGAGCAGG - Intergenic
1088544664 11:110947395-110947417 AGGGAAGGGCAGGCTGGGGAAGG - Intergenic
1088992259 11:114963792-114963814 AGGCAATGGCAAGAATGGGCTGG + Intergenic
1089146416 11:116332445-116332467 AGGGCCAGGCATGATGGGGTGGG + Intergenic
1089167041 11:116485344-116485366 TCAGAAAGGCAACATGGGGCAGG + Intergenic
1089177842 11:116561207-116561229 AGGTAGAGGGAGGATGGGGCAGG - Intergenic
1089255205 11:117190438-117190460 AGGGCAGGGCAGGGTGGGGCAGG - Intronic
1089256053 11:117194685-117194707 GGGCACAGGCAAGACGGGGCAGG + Intronic
1089350756 11:117820379-117820401 AGACAAAGGCAGGATGGGGTTGG + Intronic
1089367225 11:117928312-117928334 AAGAAAAGTCAAGAGGGGGCTGG + Intronic
1089485993 11:118846606-118846628 AAGGAAAGGCAAGGTAGGGTGGG - Intergenic
1089537712 11:119170837-119170859 GGGGAGAGGCAAGACGTGGCAGG + Intronic
1089693168 11:120199222-120199244 AGGCAATGGGGAGATGGGGCAGG - Intergenic
1090248506 11:125234974-125234996 AGTGAAAGCCAGGATGGGGAAGG - Intronic
1090519088 11:127459620-127459642 ACTGAAAGGCAAGAAAGGGCAGG - Intergenic
1090649292 11:128792266-128792288 GGGGAAATGCATGATGGGGGTGG - Intronic
1091021766 11:132106273-132106295 AGGCAAAGGAAAGAGAGGGCGGG - Intronic
1091451836 12:576868-576890 AGCAAAAGGCCAGATGGGTCTGG - Intronic
1091803448 12:3339708-3339730 AGGGCAAGGCAGGAAGGGGTGGG + Intergenic
1091803469 12:3339792-3339814 AGGGCAAGGCAGGAAGGGGTGGG + Intergenic
1092259755 12:6946518-6946540 AGGAAAAGGACAGGTGGGGCGGG - Intronic
1092758533 12:11788045-11788067 AGGGAAAGGCATGATGGATGAGG - Intronic
1095239553 12:39840463-39840485 AGAGACAGGCAAGATGGGCAGGG - Intronic
1095306996 12:40650618-40650640 AAGGAAAGGCAAGATAGGGGTGG + Intergenic
1095531130 12:43188104-43188126 ACAGAAAGGCAAGAAGGGGGAGG - Intergenic
1095969946 12:47894717-47894739 AGTGACAGGCAGGGTGGGGCGGG + Intronic
1096439307 12:51626116-51626138 TGGGAAAGGCAAGGCAGGGCAGG + Intronic
1096573696 12:52539842-52539864 AGGGAGAGAGGAGATGGGGCTGG - Intergenic
1096795065 12:54071601-54071623 AGGCAGAAACAAGATGGGGCAGG + Intergenic
1097243304 12:57591143-57591165 AGGGCGAGGCAGGACGGGGCGGG - Intergenic
1097269747 12:57766702-57766724 AGGAAAAGGCGAGTTGAGGCTGG - Intronic
1097633053 12:62087632-62087654 AGGGATAGGTAAGATGTGGTAGG + Intronic
1098357975 12:69629005-69629027 AGGGGGAGGAGAGATGGGGCAGG + Intergenic
1099036347 12:77592178-77592200 AGTGAAAGTCAACATGGGGCTGG + Intergenic
1099334983 12:81344107-81344129 AGGGAAAGGCAAGACAAGGCAGG - Intronic
1099335583 12:81352474-81352496 AGGGAAAGGGAAAGTGAGGCAGG - Intronic
1100260778 12:92929852-92929874 AGGGAAAGGAAACCTGGGACTGG - Intergenic
1100277016 12:93080705-93080727 AGGGAAAGGCAAGATGGGGGTGG + Intergenic
1100338991 12:93660138-93660160 CAAGAAAGGCAAGATAGGGCAGG - Intergenic
1100956323 12:99913151-99913173 AGGGCAAGGCAAGCTAGGGAAGG - Intronic
1101373667 12:104152637-104152659 AGGAAAAGGCAAGGTGGGGCTGG - Intergenic
1101593252 12:106140576-106140598 TGGGGAAGGGAAGAAGGGGCAGG - Intergenic
1101782598 12:107849076-107849098 AGTGAGAGAAAAGATGGGGCAGG - Intergenic
1101854057 12:108427531-108427553 AGGGAAAGGGGAGAGGAGGCAGG + Intergenic
1102110070 12:110358444-110358466 AGGGAAACTCCAGATGGGGTGGG + Intergenic
1102260927 12:111442882-111442904 AGAGACAGGCAAGTCGGGGCAGG - Intronic
1102975132 12:117201413-117201435 AGGGAAAGGAAAGCTAAGGCCGG - Intergenic
1102990407 12:117311592-117311614 TCTGAAAGGCAAGGTGGGGCAGG + Exonic
1104033035 12:125078967-125078989 TGGGAAAGGGATGATGGGGTGGG + Intronic
1104178768 12:126357837-126357859 AGGGAAAGGGAAGAGAGGGGAGG + Intergenic
1104348745 12:128026516-128026538 AGAAAAAGGCAAAATGGGGGTGG + Intergenic
1104634062 12:130426826-130426848 AAGGAAAGGCATCAGGGGGCGGG + Intronic
1104647569 12:130508279-130508301 AGGGAGAGGCAAGATCTGGCAGG - Intronic
1104932104 12:132345307-132345329 AGGGTCAGGCAGGTTGGGGCAGG - Intergenic
1105409251 13:20157591-20157613 AGGGGAAGGGAAGTTGGGCCAGG - Intronic
1105986534 13:25572718-25572740 AGGGAAAGGCAAGGGATGGCAGG - Intronic
1106522540 13:30510503-30510525 AGGAATAGGCAAACTGGGGCTGG - Intronic
1106567394 13:30898104-30898126 GGGGAAAGGCAAGGCAGGGCAGG + Intergenic
1106582022 13:31027062-31027084 AAGGAAAGGCAAAATGAGCCTGG - Intergenic
1107605042 13:42048647-42048669 AGGGAAACGGAAGATGGCGGCGG + Intronic
1108590854 13:51911893-51911915 AGGGAAAGGCAAGGAGGGGAAGG - Intergenic
1112163768 13:96895981-96896003 AGGGAAGGGCAAGATGGGGGTGG + Intergenic
1112295193 13:98180046-98180068 AGGGAAAGGCTGCATGGGGTGGG + Intronic
1112654573 13:101436655-101436677 AGGAAGAAGCAAGATTGGGCAGG + Intergenic
1113007572 13:105724440-105724462 AGAGAAAGAAAAGATGGGACTGG - Intergenic
1113033263 13:106017714-106017736 GGAGAAAGGGCAGATGGGGCAGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113833809 13:113315660-113315682 ATTGAAAGGCAAGATGGGCCGGG - Intronic
1114346824 14:21805356-21805378 CAAGAAAGGCAAGATAGGGCAGG + Intergenic
1114817427 14:25977061-25977083 ATGAAAAAGCAAGATGGGGAAGG + Intergenic
1114976375 14:28105651-28105673 AGGAAATGGCAAGATGGGTCTGG + Intergenic
1115496161 14:34006914-34006936 CCAGAAAGGCAAGATGGGCCCGG + Intronic
1115600374 14:34950177-34950199 AGGGTAAGGAAAGATGTCGCTGG - Intergenic
1116350229 14:43852202-43852224 AGGGAAAGGAAAAATGTGCCAGG - Intergenic
1116610072 14:47057717-47057739 AGGGCAGGGCAAGGTAGGGCAGG - Intronic
1116827150 14:49683701-49683723 AAGGAAAGGAAAAATGAGGCAGG + Intronic
1116835523 14:49766509-49766531 CTGGAAAGGCAAGCTGGGTCTGG + Intergenic
1117217629 14:53568227-53568249 AGGGATAAGCAAGATGGGTATGG + Intergenic
1117287025 14:54295816-54295838 AGGGAAAGGGAGCATGGTGCAGG - Intergenic
1117698764 14:58392987-58393009 AGGGAAAGGAAGGATGGAGAAGG + Intergenic
1118259746 14:64235827-64235849 AGGGCAGGGCAGGATGGGGGAGG - Intronic
1119881918 14:78106418-78106440 AGGGAGAGGGAAGATGTGGTTGG + Intergenic
1119894941 14:78212034-78212056 AGGGAAAGTATAGATGGAGCTGG + Intergenic
1120101118 14:80446897-80446919 AGGGACAGGACAGGTGGGGCAGG - Intergenic
1120455107 14:84719749-84719771 AGCACAAGGCAAGATGGGCCAGG - Intergenic
1120495882 14:85234686-85234708 AGGGAAAGGCAATGTGTGGATGG - Intergenic
1120565533 14:86050999-86051021 AGGGAGAGGGAAGAGGAGGCGGG - Intergenic
1120590793 14:86371221-86371243 AGGGAGAGGAAAGATGATGCAGG - Intergenic
1120929562 14:89835112-89835134 AGTGACAGGGAAAATGGGGCAGG + Intronic
1120985655 14:90332106-90332128 AGGGCAAAGCAGGGTGGGGCGGG + Exonic
1121065836 14:90963922-90963944 AGGGAAAGACAAGCTGAGGCTGG + Intronic
1121522705 14:94597404-94597426 AGGGAAAGAGAAGGTGGGGTGGG + Intronic
1121671566 14:95714242-95714264 GGCGTAAGGCAGGATGGGGCGGG + Intergenic
1121956933 14:98222885-98222907 AGGGATGGGAAGGATGGGGCTGG - Intergenic
1121986015 14:98506704-98506726 AGTGAATAGCAAGATGGTGCTGG + Intergenic
1121987462 14:98521568-98521590 AGAGAATAGCAAGATGAGGCTGG + Intergenic
1122361100 14:101164872-101164894 AGGAAAGTGCAAGATGGGCCTGG - Intergenic
1122363886 14:101183153-101183175 AGGGGAAGGGAAGAAGGAGCAGG - Intergenic
1122529995 14:102418765-102418787 AGGAGAAGACAGGATGGGGCGGG + Intronic
1122654814 14:103251042-103251064 GGTGAAAGGTAAGATGGAGCTGG - Intergenic
1122671953 14:103379423-103379445 AGGAAAAGCCAAGGAGGGGCGGG + Intergenic
1122851685 14:104536726-104536748 ACTGAAAGGCAAGATTGGGCTGG - Intronic
1122980909 14:105192077-105192099 AGGGCAATGCCAGATGGGGATGG - Intergenic
1124822244 15:33057972-33057994 AGTGAAAAGTATGATGGGGCTGG + Intronic
1126052104 15:44695423-44695445 AGGGGCAGACAAGATGGCGCTGG + Intronic
1126065121 15:44820523-44820545 AGGGGAAGGCAAGTTGGGGTTGG + Intergenic
1126094708 15:45080060-45080082 AGGGGAAGGCAAGTTGGGGTTGG - Intergenic
1126157872 15:45582239-45582261 AGGGAAAAGCAAGATGGGTTTGG + Intergenic
1126529571 15:49698410-49698432 AAGGAAAGGCAAAATGAGACAGG - Intergenic
1126930046 15:53637754-53637776 AGGGAGAGAGAATATGGGGCTGG - Intronic
1127282602 15:57504741-57504763 AAGGAAATGCAAGAAGTGGCAGG - Intronic
1127395628 15:58541975-58541997 AGGTGAAGGAAGGATGGGGCAGG - Intronic
1127926129 15:63544792-63544814 AGTGAAAGGGAAGATTGGGAGGG + Intronic
1128125035 15:65185720-65185742 AGGGAAGGTCAAGGTGAGGCTGG + Intergenic
1128255284 15:66191583-66191605 AGAGGAAGGCAAGATGTGGTGGG + Intronic
1128562403 15:68677513-68677535 TGGGAAAGGCCAGATGGTGGCGG + Intronic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128748992 15:70135065-70135087 GGGGATAGGCAGGATGGTGCCGG - Intergenic
1129044838 15:72725664-72725686 AGGGGAAGGGAAAATGGGGAAGG - Intronic
1129295294 15:74596880-74596902 AGGGAAGGGCCAGAGGGGCCGGG - Exonic
1129324365 15:74792330-74792352 AGGGAATGGCAAGGCGGGGAGGG + Intronic
1129657461 15:77533724-77533746 AGGGAAAGGAAAGCAGGGGAGGG - Intergenic
1129889086 15:79059193-79059215 AGGGAAGGGAAAGATAGGGAAGG - Intronic
1130321631 15:82847350-82847372 AGGGAAAGGTAAGTTGGGCTTGG - Intronic
1130576455 15:85097218-85097240 AGGGAAAGCCAGGATGGAGCTGG - Intronic
1130957748 15:88639256-88639278 AGGGTAAGGCCAGCTGGGGTTGG + Intronic
1131542795 15:93288894-93288916 AGTGAATGGCAGCATGGGGCAGG - Intergenic
1131553102 15:93374750-93374772 AGGCAGAGGCAGGATGGGGTTGG + Intergenic
1131597312 15:93811586-93811608 AGCCAAAGGCAAAATGGGGTGGG + Intergenic
1132240470 15:100253534-100253556 AGGGGAAGGGAAGATGAGGGAGG + Intronic
1132535497 16:477477-477499 TGGGGAAGGCATGACGGGGCAGG - Intronic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1132894751 16:2223515-2223537 AGGGAACGGCAAGAGGAGGGCGG - Intergenic
1132976845 16:2715392-2715414 GGGGAAAGGCCAGGAGGGGCCGG + Intronic
1133002017 16:2856570-2856592 AGGGTAAGGAAAGAGGGGGAGGG - Intronic
1133835807 16:9366354-9366376 ATGGAAGGGAAAGATGGGTCAGG + Intergenic
1134001641 16:10787474-10787496 AGGGGCAGGCAACATGGGGCAGG + Intronic
1134004787 16:10811090-10811112 GGGGAAAGGGAAGATGGGTAGGG + Intronic
1135047707 16:19168456-19168478 AGGGAAAGGCAAGGACGGGGCGG + Exonic
1135178068 16:20248810-20248832 AGAGAAAGTCGAGATGGGGGAGG - Intergenic
1135732457 16:24906583-24906605 AGGCCCAGGCAACATGGGGCCGG - Intronic
1136062990 16:27739431-27739453 TGGGGAAAGCAAGATAGGGCAGG - Intronic
1136227544 16:28869181-28869203 AGAGACAGGGAAGATGGTGCTGG - Intronic
1136514163 16:30757659-30757681 AGGGGCAGGGAAGAAGGGGCAGG + Exonic
1136621032 16:31428314-31428336 AGGCAAAGCCATGATGGTGCGGG + Exonic
1137029139 16:35506239-35506261 AGGGAGGAGCAAGAAGGGGCGGG + Intergenic
1137486490 16:48895623-48895645 TGAGAAAGGCAGGATGGGGCAGG + Intergenic
1137520829 16:49194034-49194056 AGGGACAGGCAAGATTGTCCAGG + Intergenic
1137580929 16:49633016-49633038 AGGGAAAGGCCAGCTGGGGTGGG - Intronic
1137869870 16:51939786-51939808 AGAGAGAGCCAAGATGGGGGAGG - Intergenic
1137953485 16:52806082-52806104 AGACAAAGGCCAGATGGTGCAGG + Intergenic
1138103649 16:54274834-54274856 TGGGAAATGCAGAATGGGGCTGG - Intergenic
1138111863 16:54330421-54330443 AGAGAAAGGAAAGAGGGGGTAGG - Intergenic
1138153936 16:54685773-54685795 AGGGAAGGGGAAGAAGGGGAAGG - Intergenic
1138350978 16:56346064-56346086 AGAGAAAGGCAGGCTGGGGATGG - Exonic
1138385235 16:56632123-56632145 AGGGACAGGCAAGGCGGGGAAGG + Intergenic
1138539643 16:57680218-57680240 AGGGAAAGGGAATATAGGGAGGG - Intronic
1139064452 16:63294889-63294911 AGGGAAAGGCAATATGGGAAAGG - Intergenic
1139310938 16:66027437-66027459 AGGCAAAGGCAAGAAGGGACTGG + Intergenic
1139444407 16:66988037-66988059 AGTCAAAGGTAAGATGGGGCTGG - Intergenic
1140228145 16:73095277-73095299 AGGGAGAGGCAAGATGGGTGTGG - Intergenic
1140699087 16:77564672-77564694 AGAGAATGGCAAGCTGGGGGTGG + Intergenic
1141141734 16:81500788-81500810 AGGGAAAGGAAACAGTGGGCCGG - Intronic
1141150273 16:81559849-81559871 AGAGAAAGGCATTGTGGGGCTGG + Intronic
1141545083 16:84761476-84761498 AGGGAAAGGACAGGTGAGGCAGG + Intronic
1142960857 17:3551729-3551751 AGGGAATGGCACGATGGTTCAGG + Intronic
1143651518 17:8266667-8266689 AGGGAAATGCAGGAAGGGCCAGG - Intronic
1143959151 17:10700056-10700078 AAGGAAAGTTAAGTTGGGGCAGG - Intronic
1144196444 17:12899599-12899621 AGGTAAAGGGAAGGTGGGGTGGG + Intronic
1144826892 17:18110187-18110209 GGTGAGAGGCTAGATGGGGCTGG - Intronic
1145271353 17:21406517-21406539 AGGGATGGGGAAGAAGGGGCTGG + Intronic
1145309558 17:21693921-21693943 AGGGATGGGGAAGAAGGGGCTGG + Intronic
1145748829 17:27340825-27340847 AGGCAAATGCGAGATGGGGGTGG + Intergenic
1145815150 17:27789842-27789864 AGGAAGAGGGAAGATGGGGATGG - Intronic
1145909701 17:28535211-28535233 TGGGAAAGGGAAGGTGGGACAGG + Intronic
1146763267 17:35496525-35496547 AGGGAAGGGAAAGGAGGGGCCGG - Intronic
1146956774 17:36940582-36940604 AGGGAAAGGACAGATGAGCCGGG - Intronic
1147438243 17:40431107-40431129 AGGGAAATCCAAGATGGTCCTGG + Intergenic
1147457966 17:40550388-40550410 AGGCAGGGGGAAGATGGGGCAGG - Intergenic
1147582969 17:41637175-41637197 AGGGGGAGTCAAGGTGGGGCTGG - Intergenic
1148123386 17:45224937-45224959 AGGGGAAGGCATGAAGGGGCTGG - Intronic
1148281776 17:46353943-46353965 AGGAAAAGGGAAGCTGGGGAAGG - Intronic
1148304001 17:46571882-46571904 AGGAAAAGGGAAGCTGGGGAAGG - Intronic
1148455945 17:47811415-47811437 TGTGAAGGGCAGGATGGGGCTGG - Intronic
1148700407 17:49583343-49583365 AGGCAGAGGCAAGATGGGGTGGG + Intronic
1148955682 17:51351806-51351828 CGGGAAAGGAAGGAAGGGGCAGG - Intergenic
1149614272 17:57985625-57985647 AGGAAAAGGAAAGCTTGGGCAGG - Intronic
1149999686 17:61425953-61425975 AGGGAGAGGAAGGATGGGACAGG + Intergenic
1150221984 17:63500943-63500965 AGGGAGAGGCAACATGGGGAGGG - Intronic
1150225646 17:63523225-63523247 AAGGAAAGGAGAGGTGGGGCAGG + Intergenic
1150243781 17:63658305-63658327 AGGGAAAGGCAAGGTGTTGTGGG - Intronic
1150289558 17:63973526-63973548 AGGGAAAAGAAAGATGGGGGTGG + Intergenic
1150830194 17:68512135-68512157 AGGGACAGGTAAGGAGGGGCAGG + Intronic
1150926685 17:69539698-69539720 AACAAAAGGCAAGGTGGGGCTGG + Intronic
1151243433 17:72776004-72776026 AGGGAGAGGGAACATGTGGCAGG - Intronic
1151281370 17:73077139-73077161 AGGGAAAGGCAGTATGGCCCAGG - Intronic
1151308657 17:73280112-73280134 ATGGAATGACAAGGTGGGGCCGG - Intergenic
1151325841 17:73379405-73379427 TGGGAAAGGCATGCTGGGGCCGG + Intronic
1151563631 17:74884621-74884643 AGGGAAGGGGAAGAGGGAGCAGG + Intronic
1151768097 17:76142333-76142355 AGGGAAAGGCATGTTGGCGGGGG - Intergenic
1151830730 17:76548524-76548546 AGGGACAGGCAGGGTTGGGCTGG - Intronic
1151887184 17:76930009-76930031 AGGGGAGGGGAAGATGGTGCCGG + Intronic
1152710169 17:81867424-81867446 AGGGAATGGGAAGACGGGCCTGG - Intergenic
1153159917 18:2192439-2192461 GGCAAAAAGCAAGATGGGGCTGG - Intergenic
1154501958 18:15001616-15001638 AGGGCAAGGCAAGGCAGGGCTGG - Intergenic
1155143945 18:23068281-23068303 GGTTAAAGGCAAGATGGGGTTGG - Intergenic
1155213356 18:23621093-23621115 AGAGAAAGGCAGGAGGGAGCAGG + Intronic
1155302614 18:24444898-24444920 ATCAAAAGGAAAGATGGGGCAGG - Intronic
1155315787 18:24568839-24568861 AAGGAAAGGGAAGATACGGCCGG - Intergenic
1155769864 18:29682928-29682950 AGGAATAGGCAACATGGTGCTGG - Intergenic
1156163051 18:34383443-34383465 AGGGAATGGCCAGATGTGGCTGG - Intergenic
1156359260 18:36369875-36369897 AGTGAAAGGCAGGGTGGTGCAGG + Intronic
1156437859 18:37153015-37153037 AGGAACAGGCAACATGGTGCTGG + Intronic
1156609909 18:38713760-38713782 AGGGATAGACAGGATGGGGTGGG + Intergenic
1157213346 18:45762297-45762319 AGGCAGAGTCAAGAAGGGGCGGG + Intergenic
1157348720 18:46865241-46865263 AAGTAAAGGCAAAATGAGGCCGG + Intronic
1157373595 18:47141764-47141786 AGGAAAAGACAAGATGAGTCTGG - Intronic
1157483471 18:48070789-48070811 TGGGAAGGGCAGGATGGGGTGGG - Intronic
1157854941 18:51097003-51097025 AGGGAAAGGCAGGAGGAGGGAGG - Intergenic
1158191770 18:54837441-54837463 AAGGAAAGGCAGGTTGGGGGAGG + Intronic
1158438885 18:57455792-57455814 AGGGAAAAGGAAGTAGGGGCAGG + Intronic
1159502998 18:69298083-69298105 AGGGAAAGGAAGAATGGGGGAGG - Intergenic
1159687371 18:71438920-71438942 AGGGAATGGGGAGATGGGGAAGG - Intergenic
1160307233 18:77751364-77751386 AAGGAAAGGAAAGCTGAGGCTGG + Intergenic
1160711165 19:551635-551657 AGGGAAAGAGAAGAAGGGGAAGG - Intergenic
1160761882 19:789593-789615 AGAGAAAGGCAGGAAGGGCCCGG - Intergenic
1161280177 19:3441666-3441688 AGGGAAGGGCCAGAGGGGCCGGG + Intronic
1161678691 19:5667884-5667906 AGGGTAAGGCATGCTGGGGGCGG + Exonic
1161994801 19:7705657-7705679 TGGGAAGGACATGATGGGGCCGG - Intergenic
1162022278 19:7873372-7873394 AGGGGGAGGGAAGATGGGGGCGG + Intronic
1162463975 19:10829960-10829982 AGGGCAAGGGAAGGTGGGACTGG + Intronic
1162480837 19:10926205-10926227 AGGGAAAAAAAAGAGGGGGCTGG - Intronic
1162758233 19:12873213-12873235 AGGGAAGGGCCAGAAGGGGTGGG + Intronic
1163117414 19:15196893-15196915 AAGGAAAGGCAAGAGGTTGCAGG - Intronic
1163253211 19:16139152-16139174 AGCAGAAGGCAAGATCGGGCCGG - Intronic
1163809313 19:19420634-19420656 AAAAAAAGTCAAGATGGGGCTGG - Intronic
1164419070 19:28071868-28071890 AGGGAAAGGCAGGAGAGAGCTGG + Intergenic
1164520118 19:28972757-28972779 GAGGAAAGGCAAGATGTGGGAGG + Intergenic
1164699960 19:30278256-30278278 AGGGAAAGGCAAGGCAAGGCAGG + Intronic
1165013899 19:32867019-32867041 AGGGAAAGGGAGCTTGGGGCTGG - Intronic
1165968278 19:39603332-39603354 AGGGACAGGCAAGCTGAGCCTGG - Intronic
1166168486 19:41009476-41009498 AGGGAAGGGGAAGATGGGGAGGG + Intronic
1166415982 19:42595290-42595312 AGGGAAGAGCCAGATGGGGATGG - Intronic
1166462852 19:43004573-43004595 AGGGAAAGGCAGGAGGGGCCGGG + Intronic
1166654386 19:44599461-44599483 AGGGCAGGGCAAGGTGGAGCAGG + Intergenic
1166693670 19:44839786-44839808 AGGGCAGGGCAAGGAGGGGCTGG - Intergenic
1166997939 19:46728576-46728598 TGGGGAAGGCAAGCGGGGGCTGG + Intronic
1167321821 19:48801347-48801369 AATGAGGGGCAAGATGGGGCAGG + Intronic
1167517421 19:49931063-49931085 AGGGCAGGGGAAGATGGGGGAGG + Intronic
1167549208 19:50148015-50148037 AGGGAATGACAAGAGGGGGCGGG + Intergenic
1167763090 19:51461728-51461750 AGGGAGAGGAACCATGGGGCTGG - Intergenic
1167891737 19:52545481-52545503 AGTTAATGGTAAGATGGGGCCGG + Intronic
1168184268 19:54688145-54688167 ATGGAAAAGAAACATGGGGCAGG + Intronic
1168522281 19:57061828-57061850 AGAGAAAGGAAGGATGGGACAGG - Intergenic
1168703940 19:58457527-58457549 AGGGAAAGGTGAGATGGAGGGGG - Exonic
1168716578 19:58532023-58532045 AGGGAAAGGAAGGAGGGGGGAGG - Intronic
925151052 2:1615120-1615142 AGGGGAGGGCAAGGTGGGGTGGG + Intergenic
925726562 2:6878197-6878219 GGGGTAAGGCGAGAAGGGGCTGG + Intronic
926383908 2:12317299-12317321 AGGGAAAGGCAAGATAAGGATGG + Intergenic
926645454 2:15285953-15285975 AGGAAAAGGCAAGAGAGGCCAGG - Intronic
926717050 2:15933023-15933045 ATGGAAAGGCAACATGGGAAAGG + Intergenic
927430587 2:23023409-23023431 AGGGGGAGGCAAGGTGTGGCTGG - Intergenic
927608988 2:24517432-24517454 AGGGAAATCCAAGAAGGGCCTGG - Intronic
927753956 2:25693851-25693873 AAGAAAAGGCAAGGGGGGGCCGG + Intergenic
928171534 2:29007595-29007617 AGGAAAATGAAAGATGGGGATGG - Intronic
928204283 2:29273053-29273075 AGGGATAGGCCAGAGGGGGAAGG - Intronic
928310399 2:30204923-30204945 AGGGAAAAGCAACATGTGCCTGG - Intergenic
928379046 2:30802528-30802550 AGAGAAAGGCAGGCTGGGGGGGG + Intronic
929118602 2:38465495-38465517 AGAGACAGGCAAGAAGTGGCAGG - Intergenic
929192627 2:39153874-39153896 AGGGAAAAGTCAGGTGGGGCGGG - Intergenic
931224384 2:60317022-60317044 AGGGAAGGGAAAGATGGGAAAGG - Intergenic
931669902 2:64637797-64637819 AGCAGCAGGCAAGATGGGGCAGG - Intronic
932260342 2:70321552-70321574 AGAGGAAGGCAAGAGGTGGCGGG + Intergenic
932578916 2:72980845-72980867 AGGGGAATGCAGGAGGGGGCAGG - Intronic
932591680 2:73071348-73071370 CGGGAAAGGCTAGAGGGCGCGGG + Intronic
933148737 2:78889273-78889295 CAGGAAAGGCAAGGTGGGGCAGG - Intergenic
933513485 2:83270961-83270983 AGGGAAAGGCAAGCTGGAAGGGG - Intergenic
933645621 2:84810610-84810632 AGGGGAAGGGAAGGTGAGGCTGG - Intronic
934111845 2:88750979-88751001 AAGGAAAGCCAAGATGGGAGAGG + Intergenic
934735828 2:96689374-96689396 AAGGTAAGGCCAGAGGGGGCAGG + Intergenic
935783544 2:106529260-106529282 AGGGAAAGGGAATCTGGGGCTGG + Intergenic
936152999 2:110031880-110031902 AGGGAGAGGGAGGGTGGGGCTGG + Intergenic
936191681 2:110339532-110339554 AGGGAGAGGGAGGGTGGGGCTGG - Intergenic
936602318 2:113910083-113910105 AGGTAACTTCAAGATGGGGCTGG + Intronic
937256226 2:120557756-120557778 TGGTAGGGGCAAGATGGGGCAGG - Intergenic
937375051 2:121330538-121330560 AAAAAAAGGCAAGATGCGGCTGG + Intergenic
937657850 2:124397395-124397417 AGGGAAAGCCAAGATAGGGAGGG + Intronic
937983829 2:127629745-127629767 CAGGACAGGCAAGACGGGGCTGG + Exonic
938010576 2:127825634-127825656 AGGAACAGGCAACATGGTGCCGG + Intergenic
938397945 2:130964316-130964338 AAGGAAAGGCAGGAGGGGGGCGG - Intronic
938399272 2:130975544-130975566 AAGGCAAGGCAAAGTGGGGCAGG - Intronic
938446447 2:131383776-131383798 AGGGAAATGCTATATGGGGGGGG + Intergenic
939724529 2:145700149-145700171 CGGGAGCGGCAAGATGGGGATGG - Intergenic
939821236 2:146959273-146959295 AAGGAAAACCAAGATGGGGTGGG + Intergenic
939999413 2:148951834-148951856 AGAGAAAGGACAGATGGGGGTGG + Intronic
940362043 2:152806026-152806048 AGTGAAAGGCAAGATCTGTCTGG + Intergenic
940781023 2:157933726-157933748 AAGGGAAGGCAGAATGGGGCTGG + Intronic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
941900356 2:170672216-170672238 AGGGATGGGGGAGATGGGGCGGG + Intergenic
942310218 2:174649551-174649573 TGGGAAAGGCAAGGCAGGGCAGG - Intronic
942315318 2:174692221-174692243 AGGCAAAGGTCAGATGGGGCTGG + Intergenic
942351443 2:175057419-175057441 TGGGAAAGGCAAGGCAGGGCAGG - Intergenic
942941494 2:181624063-181624085 AAGGAACGGTAAGATGTGGCTGG + Intronic
943030845 2:182683821-182683843 ATAGAAATGCAAAATGGGGCTGG + Intergenic
943118172 2:183700048-183700070 AAAGTAAGGCAAGATGGGGATGG + Intergenic
943464515 2:188212222-188212244 AGGGTAATGCAAGATGGTGGGGG + Intergenic
943521459 2:188955944-188955966 AGGGAAAGGAAGGAAGGGGAGGG + Intergenic
944450128 2:199834213-199834235 AGTGCAAGCCAAGATGGGACAGG + Intronic
944518751 2:200541412-200541434 TAGGAAAGGCAAGACAGGGCAGG - Intronic
945167665 2:206963127-206963149 AGCGAAATGCAAGCTGGAGCAGG + Intronic
945372397 2:209035389-209035411 AGGGGATGGCAAGTTGGGGGAGG + Intergenic
945851258 2:215010452-215010474 AGGGAGAAGCAAAATGGTGCTGG + Exonic
945879531 2:215311922-215311944 AGGGAACGGCGGGATGGGGTGGG - Exonic
946026076 2:216672729-216672751 GGGGAAAGGGAAGGTGGGGAGGG - Exonic
946159233 2:217826032-217826054 AGGGCAGGGCCAGGTGGGGCTGG - Intronic
947710725 2:232314065-232314087 AGGGAAAGGTGGGATGGGGCAGG - Intronic
947889844 2:233607711-233607733 CAGGAAAGGCAAGATAGGGCAGG + Intergenic
947895271 2:233665564-233665586 CAGGAAAGGCAAGGTAGGGCAGG + Intronic
948374868 2:237514804-237514826 AGTGGAAGGAAAGATGGGGGAGG - Intronic
948506819 2:238434016-238434038 CGAGAAACCCAAGATGGGGCAGG - Intronic
948691340 2:239706939-239706961 AGGGCAAGGCAAGGCAGGGCAGG - Intergenic
948691433 2:239707214-239707236 AGGGCAAGGCAAGGCAGGGCAGG - Intergenic
948691497 2:239707404-239707426 AGGGCAAGGCAAGGCAGGGCAGG - Intergenic
1169065971 20:2694204-2694226 TGGGAAAGGAAAAAGGGGGCTGG - Intronic
1169082290 20:2804989-2805011 AGGGAAAGGAGAGGAGGGGCAGG - Intergenic
1169334993 20:4748663-4748685 AGGGAAAGGCAAGACCTGGCTGG + Intergenic
1169340087 20:4789997-4790019 AGGGATCAGCAAGATGGGGTGGG + Intronic
1169977862 20:11350811-11350833 AGAGAAGCACAAGATGGGGCTGG - Intergenic
1170700016 20:18695460-18695482 AGGGAAGGGAAAGAAGGGGAAGG - Intronic
1171024652 20:21618493-21618515 AGGAAAATGCAAGATGAGCCTGG - Intergenic
1171138460 20:22719555-22719577 AGGGAAAAGCAGGGTGGGGTGGG + Intergenic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1172190575 20:33059751-33059773 AGGGAAGTGCAAAATGGGGCAGG + Intronic
1173377550 20:42501089-42501111 GGGGAAAGGCGTGATGGGGTGGG - Intronic
1173585660 20:44181103-44181125 TGGGAAGGGGAAGGTGGGGCTGG - Intronic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1174478004 20:50810929-50810951 AGGGAAAAGTAAATTGGGGCAGG + Intronic
1174851632 20:54001229-54001251 AGTTAAAGGCAAGATGGTGTTGG - Intronic
1174934949 20:54857250-54857272 TGGGAAAGGCAGGATGGGGTAGG - Intergenic
1175023127 20:55872718-55872740 AGGGAAAGGAAAGCTGTGGGTGG - Intergenic
1175242041 20:57556850-57556872 AGGGACAGCCAAGATGCAGCAGG - Intergenic
1175739925 20:61413200-61413222 AGGGAAAGGGAGCATGGGCCAGG - Intronic
1175851855 20:62097924-62097946 AGGGAAATGGAAGATGGGAAGGG + Intergenic
1175899391 20:62354062-62354084 AGGCAGAGCCAAGGTGGGGCTGG - Intronic
1176667856 21:9704166-9704188 AGGGAAAGTCATGAGGGAGCTGG - Intergenic
1176951364 21:15051040-15051062 TGGGAAAGGCAAGGCAGGGCGGG - Intronic
1177737378 21:25108370-25108392 AGTGAAAAGCAAGATGGAGTTGG + Intergenic
1179088878 21:38245142-38245164 AGGGGAAGGCAAGGCGGGGCTGG + Intronic
1179122225 21:38558582-38558604 ATGGAAATGCAAGATGGAGTGGG + Intronic
1179630977 21:42678551-42678573 AGGGAAAGGCAAGAAGCAGAAGG + Intronic
1179955754 21:44737241-44737263 AGGGACAGGCGAGTGGGGGCAGG + Intergenic
1181162396 22:20966297-20966319 AGGGAAGGGGCAGGTGGGGCAGG + Intronic
1181307867 22:21927175-21927197 AGGGAAAGGCAAGGAGGACCAGG + Intronic
1181636985 22:24178998-24179020 AGGGAAAGGGGGGATGGGGCCGG + Intergenic
1182066228 22:27433663-27433685 AGGGGAAGGGAAGATGGTGGTGG - Intergenic
1182350454 22:29696333-29696355 AAGAAAGGGCAAGAAGGGGCTGG - Exonic
1182412564 22:30199663-30199685 AGGGAAGGGTGAGATGGGGTTGG - Intergenic
1182662759 22:31936561-31936583 AGTGAAAGGCAAGAAGAGGGAGG - Intronic
1182710284 22:32318421-32318443 TGGGAAAAGCTAGATGGGGGAGG - Intergenic
1183316292 22:37138832-37138854 AGGGATAGGCAAGGTGGGTTTGG + Intronic
1183672675 22:39282465-39282487 AGGGACACGCAAGAGGGGGCTGG - Intergenic
1183848403 22:40562586-40562608 AGGGAAAGGGAAGGAGGGGAAGG + Intronic
1184484878 22:44770971-44770993 AGTTAAAGGCAAGATGGAGTTGG + Intronic
1184496472 22:44845335-44845357 AGAGAAAGGTGAGACGGGGCCGG + Exonic
1184982663 22:48105356-48105378 GGGGAGAGGAAAGATGGGGCAGG + Intergenic
1185058728 22:48594456-48594478 CGGGGATGGGAAGATGGGGCTGG + Intronic
949250114 3:1973348-1973370 AGGGAAAGGAAGGAAGGGGAGGG + Intergenic
949318740 3:2785852-2785874 TGGGAAAGGCAACATGTGGGTGG - Intronic
949828380 3:8186420-8186442 AGGGAAATGCTAGATAGGGGAGG - Intergenic
950100244 3:10352286-10352308 AGGGTAAGGAAAGAGGGGCCAGG - Intronic
950608560 3:14108262-14108284 GGGGAAATGCAAGATGAGCCTGG - Intergenic
950616908 3:14167143-14167165 AGGGCAAGGAATGATGGGGAAGG - Intronic
950631799 3:14286909-14286931 AGGGGAACGTAACATGGGGCTGG - Intergenic
952105079 3:30059947-30059969 AGGGAAAGGTGAGGTAGGGCAGG - Intergenic
952747025 3:36791121-36791143 AGGGAAAGGGAAAAGGGAGCAGG + Intergenic
952944568 3:38469243-38469265 AGGGAAAAACAAGAAGGAGCTGG + Intronic
953004499 3:38965548-38965570 AGAGAAGAGCAAGATGTGGCTGG - Intergenic
953409414 3:42681589-42681611 AGAGAAACACAAAATGGGGCCGG - Intergenic
953828859 3:46278119-46278141 AAAGAAAGGCTACATGGGGCTGG + Intergenic
953839398 3:46377014-46377036 AAGGAAGGGCAGGAGGGGGCTGG + Intergenic
954595529 3:51820832-51820854 AGGGAAAGGCAAGGCAGGGCAGG - Intronic
954807202 3:53227397-53227419 AGGCAGGAGCAAGATGGGGCTGG - Intronic
954810875 3:53246918-53246940 AGGGGAAGGGAAGATGAGGATGG + Intronic
954936592 3:54332780-54332802 TGGTCAAGGAAAGATGGGGCAGG - Intronic
955126331 3:56115994-56116016 AGGGAAAGAAGAGATGGGGCAGG - Intronic
955808347 3:62760072-62760094 AGGGAGGTGCAAGATGGAGCAGG - Intronic
957259644 3:77884351-77884373 AGAGAAAAGCAAGAAGGGACAGG - Intergenic
957405184 3:79766749-79766771 CGGGGCTGGCAAGATGGGGCAGG + Intronic
958482208 3:94657143-94657165 AGGGAAAGTCAAGACAGCGCAGG - Intergenic
958734565 3:97993749-97993771 AAGGAAAGGGAAGAGGGGGAGGG - Intronic
959616747 3:108357256-108357278 CGGGAAGGACAAGATGGAGCTGG + Intronic
960203865 3:114871193-114871215 AAAGAAAGGGGAGATGGGGCAGG - Intronic
960550490 3:118970992-118971014 AGGGCATGTCAAGCTGGGGCTGG - Intronic
960991337 3:123313549-123313571 AGGGAAAGGCCTGATGGGCAGGG + Intronic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961265052 3:125634927-125634949 GGGGAGAAGGAAGATGGGGCAGG + Intergenic
961334583 3:126164144-126164166 AAGGCAAGGCAAGGTAGGGCGGG + Intronic
961489757 3:127246681-127246703 AGGGAGAGTCTAGATGGGACAGG + Intergenic
961523743 3:127483613-127483635 AGGGACAGGCACCATGGGGTGGG - Intergenic
961599708 3:128051583-128051605 AGGGCAAGGGATGCTGGGGCTGG - Intergenic
962341648 3:134590567-134590589 TGGGAAAGGAAGAATGGGGCTGG + Intergenic
962762374 3:138527106-138527128 AGGGAAAGGCAAAGAGGGGCAGG + Intronic
962791796 3:138817988-138818010 AGCTTAAGTCAAGATGGGGCTGG + Intronic
963284213 3:143417466-143417488 AGGGAAAGGGAGAATGGAGCGGG + Intronic
963814337 3:149813000-149813022 AGGGAAGAGCAGGGTGGGGCAGG - Exonic
964236436 3:154535923-154535945 GAGGAAAGGAAAGATGGGGAGGG - Intergenic
964885823 3:161481179-161481201 AAGAAAAGGCCAGCTGGGGCTGG + Intergenic
964998336 3:162917652-162917674 AGGGAAGGGCCAGATGAGACAGG - Intergenic
965470147 3:169080417-169080439 AAGAAAAGCCAAAATGGGGCCGG - Intergenic
965505252 3:169507954-169507976 AAGAAATGGCAAGTTGGGGCCGG - Intronic
966869309 3:184279682-184279704 AGGGAAAGGCTAGGTGTGTCTGG + Intronic
966993173 3:185254585-185254607 AGCTAAAGGCAAGATGGGGTTGG - Intronic
967243670 3:187465786-187465808 AGGGAATGGCAAGAAGGTGGGGG + Intergenic
967817749 3:193813497-193813519 AGGGAGAGGCAATAGGGGACTGG + Intergenic
967862250 3:194160841-194160863 AGGGAAAGGCAAAGTGGAACAGG + Intergenic
967923428 3:194629437-194629459 ACGGAAGGGCAGGAAGGGGCTGG + Intronic
967937017 3:194737152-194737174 AGAGAAAGGCAGGGTGGGGAGGG - Intergenic
967947438 3:194815147-194815169 ATGGAAAGGCAAGCTGGGCTAGG - Intergenic
968517290 4:1020683-1020705 AGGGAATGGGGCGATGGGGCGGG + Intronic
968986125 4:3875397-3875419 AGGGAAATACAAGAGGGGCCTGG - Intergenic
969654623 4:8489377-8489399 AGGGAAAGGTAAGATGGGGGTGG - Intronic
970020848 4:11566877-11566899 AGGGAAATGCCAGATAAGGCTGG - Intergenic
970369780 4:15395147-15395169 TGGGAAAAGCAAGACAGGGCAGG + Intronic
970397403 4:15682255-15682277 AGGGAAATGCAAGAGGTGGAAGG + Intronic
971035437 4:22688001-22688023 AGGGAACGTGAAGAAGGGGCAGG - Intergenic
971483327 4:27133892-27133914 AGGGAGAGGGAACATGGGGGTGG + Intergenic
971511066 4:27424568-27424590 AGGGAAAGACTAAATGAGGCTGG - Intergenic
971947821 4:33304425-33304447 ACAGAAAGGCTAGGTGGGGCTGG - Intergenic
972872668 4:43319736-43319758 AGGGAAAAGCAGGACAGGGCAGG - Intergenic
973056037 4:45659098-45659120 AGGGAAAGGCAAGAGGTAGATGG + Intergenic
974878324 4:67723705-67723727 AGGAACAGACAAGATGGCGCTGG + Intergenic
975583045 4:75923831-75923853 AAGAAAAGGGAAGATGGGCCGGG - Intronic
976526041 4:86090097-86090119 AGGGAGGGGCAAAATGGGGAAGG + Intronic
978592358 4:110339063-110339085 AGGGAAAGGAAGGAAGGGGAAGG - Intergenic
978853724 4:113369425-113369447 ATCGAAAGGCAAGATGGAGCTGG - Intronic
979263205 4:118671751-118671773 AGGGTGAGTCCAGATGGGGCAGG + Intergenic
980253681 4:130349618-130349640 AGGCCAAGGCAACATGGGGCTGG + Intergenic
980807057 4:137828059-137828081 AGGGAAAGGAAGGAAGGGGAAGG + Intergenic
982100106 4:151959214-151959236 AGGGAAAGCCAAGAGGTGGAAGG + Intergenic
982494159 4:156068984-156069006 AGGGAAAGGCAAGAAGGGTTTGG + Intergenic
983068389 4:163238697-163238719 ATGGGAAGGGAAGATGGGGAGGG + Intergenic
984648033 4:182240679-182240701 AGGGAAAGGCAGGATCTAGCAGG + Intronic
984841078 4:184068135-184068157 GGGGAAGGGCAGGATGGGGATGG - Intergenic
985482730 5:127026-127048 AGGAGCAGGCAAGATGGCGCTGG - Intergenic
985749613 5:1666941-1666963 AGGGGTAGGCAGGGTGGGGCAGG + Intergenic
986061776 5:4198473-4198495 AGGAAAAGGGACGATGGGGCTGG + Intergenic
986342617 5:6804019-6804041 AGGGAAAGAAAGGAAGGGGCCGG + Intergenic
986442248 5:7792691-7792713 AAGGAAAGGCAAGATGGGGAAGG + Intronic
986859105 5:11904896-11904918 AGGTGATGGCAAGATTGGGCAGG - Intergenic
987264170 5:16235182-16235204 GGAGAAAGGGGAGATGGGGCTGG - Intergenic
987517510 5:18932316-18932338 TGGGAAACACAATATGGGGCTGG - Intergenic
987615100 5:20263015-20263037 AGGGAAGGGGAAGAAGGGACAGG + Intronic
987912769 5:24170179-24170201 AGGGCAGGGCAGGGTGGGGCGGG + Intronic
988224990 5:28402215-28402237 AGAGAGAGAAAAGATGGGGCAGG - Intergenic
988326627 5:29776903-29776925 ACAGAAAGGCTAGAAGGGGCTGG + Intergenic
989042436 5:37242728-37242750 AGGGATAGAAAATATGGGGCCGG + Intronic
989189883 5:38660373-38660395 AGGAACAGGCAACATGGCGCAGG + Intergenic
989236894 5:39158466-39158488 AGGGCAATGGAAGATGGAGCAGG + Intronic
989309799 5:40001605-40001627 AGGGAAATGGAAGATGGAGTGGG - Intergenic
989605312 5:43238944-43238966 AGGGAAAGGCTGGCGGGGGCGGG + Intronic
989960573 5:50409685-50409707 AGGGGAAGGGCAGATGGGGCAGG + Intronic
991123225 5:63040842-63040864 TGGGAGTGGCCAGATGGGGCGGG + Intergenic
991224348 5:64252274-64252296 AGGGAAAGGCCAGTTAGGGGAGG + Intronic
991634409 5:68689888-68689910 GTGGAAAGGAAAGATTGGGCTGG - Intergenic
992022387 5:72637216-72637238 AGGGAAAGGAAAGAGAGGGAGGG + Intergenic
992025305 5:72663889-72663911 ATGGAAAGGTAGGCTGGGGCTGG - Intergenic
993498713 5:88639246-88639268 TGGGGAAGGCAGGAAGGGGCAGG + Intergenic
993998424 5:94750101-94750123 AGGGAAAGGGAACAAGGGACTGG - Intronic
994010131 5:94892473-94892495 AGGGAAGGTCAATAGGGGGCGGG - Intronic
994884525 5:105542416-105542438 AGGAAAAAGTAAGTTGGGGCGGG - Intergenic
995285939 5:110388285-110388307 AGGCACAGACAAGATGGTGCTGG - Intronic
995881722 5:116851063-116851085 AAGAAAAGGGAAGATGGGGCTGG + Intergenic
996387490 5:122924953-122924975 AGGGAAAGGGAAGAGTGGGGAGG - Intronic
996483008 5:123997017-123997039 AGGGAATGGCAAGGCAGGGCAGG - Intergenic
996522874 5:124447023-124447045 AAGCAAAGGCAAGTTGGGGAGGG + Intergenic
997226036 5:132210248-132210270 AGGGGAAGGTAAGATGGGAATGG - Intronic
997427101 5:133810775-133810797 AGGAACAGGCAACATGGTGCTGG - Intergenic
997995003 5:138578218-138578240 AGAGAAAAGAAAGATGCGGCCGG + Intergenic
998699738 5:144684272-144684294 AGGGAAAGTCAAGATAGGGATGG + Intergenic
998798408 5:145843141-145843163 GGGGAAAGGAGAGAAGGGGCAGG + Intergenic
999140528 5:149358313-149358335 AGGGAAGGTCCTGATGGGGCCGG + Intronic
999155307 5:149453583-149453605 TGGGAAAGACAAGGTGCGGCAGG + Intergenic
999386307 5:151156661-151156683 AGGGAAAGGAAGGAGGAGGCAGG + Intronic
999627752 5:153538002-153538024 AGTGAAAGGCAAGGAGGAGCTGG + Intronic
1000280608 5:159778640-159778662 AGGGGAAGACAAGAGGGAGCTGG - Intergenic
1000410731 5:160933373-160933395 TGCTACAGGCAAGATGGGGCAGG + Intergenic
1000678022 5:164146540-164146562 AAGGAAGGGGAAGATGAGGCTGG + Intergenic
1001239072 5:170054352-170054374 AGGGAAAGGGAAGAGGGGTCAGG + Intronic
1001240734 5:170067907-170067929 AGGGAGGGGCAGGAAGGGGCAGG + Intronic
1001408634 5:171494988-171495010 AGGGAAAGGAGAGGAGGGGCTGG - Intergenic
1001482488 5:172097990-172098012 TGGGAAAGGAATGATGGGGTGGG + Intronic
1001669458 5:173461695-173461717 AGGCCAAGGCAAGAGGGTGCTGG + Intergenic
1002397758 5:178971320-178971342 AGGGAAAGGCAAGGCAGGGTGGG + Intergenic
1002568683 5:180128216-180128238 AGGGAGAGGGAGGCTGGGGCGGG - Intronic
1002946132 6:1763117-1763139 AGGGAAAGACAAGGTGGGTGAGG + Intronic
1003471289 6:6436557-6436579 AGGAACAGGCAACATGGCGCCGG - Intergenic
1003483582 6:6555412-6555434 AGGGCAAGGCAGGTTTGGGCAGG - Intergenic
1003897671 6:10623047-10623069 AGGTGCAGGTAAGATGGGGCCGG - Intronic
1004370107 6:15044891-15044913 AGGGAAAAGGAAGATGGTGGGGG - Intergenic
1004474573 6:15959370-15959392 GGCAAAAGGCAAGATGGGGTTGG + Intergenic
1004825007 6:19410147-19410169 TGGGAAAGGCAGCATGGGGCTGG + Intergenic
1005212407 6:23482034-23482056 AGGAAAAGGCAAGACAGGGCAGG + Intergenic
1005236207 6:23764990-23765012 AAGAAAAGGCAAGCTGGGGAAGG - Intergenic
1005277856 6:24238836-24238858 AGGGCAACACAAGAAGGGGCTGG + Intronic
1005986941 6:30881523-30881545 AGGACAAGGGAAGAAGGGGCTGG - Intronic
1006092581 6:31636802-31636824 AGAGAAAGGGGAGGTGGGGCAGG - Exonic
1006273248 6:32980719-32980741 GGGGTCAGGCCAGATGGGGCAGG + Exonic
1006416248 6:33905829-33905851 AGGGAAAGGCAGGGGTGGGCAGG - Intergenic
1006858254 6:37151357-37151379 AGGGAAAGGGAAGGTTCGGCCGG - Intergenic
1007323296 6:41042288-41042310 TGGGAATGGAAAGATGGAGCAGG + Intronic
1007358101 6:41335421-41335443 AGGGAAAGGCAGGCTGAGGGTGG - Intergenic
1007505426 6:42331838-42331860 AGGGAAAGGGAGGCTGGGGGTGG - Intronic
1007711101 6:43824868-43824890 AGGGAATGGGAAGGTGGGGGGGG + Intergenic
1007999792 6:46348489-46348511 GGGGAATGGGAAGATTGGGCAGG - Intronic
1008867291 6:56228077-56228099 AAGGAAATGAATGATGGGGCAGG + Intronic
1009588322 6:65635393-65635415 AGGGAAAGGCAAGATGGGGCGGG - Intronic
1010013143 6:71073275-71073297 AGGGAGAGGAAAGAGGGAGCAGG - Intergenic
1010166348 6:72919200-72919222 AAGCCAAGGAAAGATGGGGCAGG + Intronic
1010196864 6:73248295-73248317 AGGGGAAGGGAAGAGGGAGCAGG - Intronic
1010788207 6:80030313-80030335 AAGGGAAGGAATGATGGGGCTGG + Intronic
1011704593 6:89988389-89988411 AAGAAAATACAAGATGGGGCAGG - Intronic
1011722721 6:90175976-90175998 AGGGAAAGGCAAGGCAGGGCAGG - Intronic
1012114021 6:95270823-95270845 AGGGTAGGGTAAGATGGTGCAGG - Intergenic
1012401557 6:98845835-98845857 AGGGAAAGGAAAGGAGGGGTGGG - Intergenic
1012454376 6:99388550-99388572 ATGGAAAGGCAAAATAGGCCTGG + Intronic
1012692459 6:102331589-102331611 AGGAACAGCCAAGATGGGCCAGG - Intergenic
1013412940 6:109897820-109897842 CGGGAAAGGCAAGATGGGGGTGG + Intergenic
1013864045 6:114673189-114673211 AGTGGAAGGCTAGAAGGGGCTGG + Intergenic
1015730444 6:136341436-136341458 ACTTAAAGGCATGATGGGGCTGG - Intergenic
1016020292 6:139229870-139229892 AGGGCAATGGAAGATGGGGTGGG - Intergenic
1016785350 6:148005496-148005518 AGGGAAAGGAAAGAGGAGGAGGG + Intergenic
1016805208 6:148205604-148205626 AGGGAAAGGCAAGGTTGGGAAGG - Intergenic
1016929687 6:149391835-149391857 ATGGAAAGACAAGGAGGGGCCGG - Intronic
1017046718 6:150353332-150353354 AGGAATGGGCAAGAAGGGGCTGG + Intergenic
1017721982 6:157249808-157249830 AGGGAAGGTAAGGATGGGGCAGG - Intergenic
1017769133 6:157631601-157631623 AGGGAAAGGCCAGACAGGGAGGG + Intronic
1018097321 6:160400412-160400434 GGAGAAAGGCTAGAGGGGGCTGG - Intronic
1018235176 6:161716903-161716925 AGGGAAAGACAAGATGAGCCTGG + Intronic
1018722336 6:166582001-166582023 AGGGAGAGGTGAGATGGGGTGGG + Intronic
1018722378 6:166582119-166582141 AGGGAGAGGTGAGATGGGGTGGG + Intronic
1018903051 6:168060688-168060710 AGGGTCAGCCAAGCTGGGGCTGG + Intronic
1019099568 6:169617718-169617740 AGGAGCAGGCAAGATGGCGCTGG - Intronic
1019410964 7:906641-906663 AGGGAAAGGAGAAAGGGGGCGGG + Intronic
1019450900 7:1097279-1097301 AGGGAGAGACAAGATGAGCCTGG + Intronic
1019477133 7:1249507-1249529 AGGGGAAGGAAAGGGGGGGCTGG + Intergenic
1019550774 7:1601360-1601382 AGAGAAAGGAGAGAAGGGGCCGG + Intergenic
1019551887 7:1607138-1607160 AGAGAGAGGAAAGATGGGGTGGG - Intergenic
1019571695 7:1715833-1715855 AGGGATGGGCAAACTGGGGCCGG - Intronic
1019597197 7:1863667-1863689 GCGGAGGGGCAAGATGGGGCAGG - Intronic
1019641569 7:2106338-2106360 AAGGAAGGGCAGGGTGGGGCCGG - Intronic
1019641596 7:2106428-2106450 TGGGAAGGGCAGGGTGGGGCCGG - Intronic
1019841722 7:3453010-3453032 AGGCAATGGCAAGACGGGGATGG - Intronic
1020137207 7:5594054-5594076 GGGGAGAGCCAAGATTGGGCGGG - Intronic
1020477300 7:8612138-8612160 AGAGAAAGGAAAGAAGGGGAAGG - Intronic
1020835119 7:13139600-13139622 AGGGAAGTGCAAGATTGGGTGGG + Intergenic
1021432916 7:20581944-20581966 AGGGCAAGGCAGAATGGGGGAGG + Intergenic
1021851601 7:24814128-24814150 AGTGAATGACAGGATGGGGCTGG + Intronic
1022061367 7:26799071-26799093 AGGGCAAGGCAAGGCAGGGCAGG + Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023021662 7:36016952-36016974 AGAGAGAGGCAGGATGGGGCTGG - Intergenic
1023103089 7:36738789-36738811 AGGGAAAGGAAAGTGAGGGCAGG + Intergenic
1023681945 7:42696181-42696203 AGTGAAAGGCACGATGGGAGAGG - Intergenic
1024199333 7:47090344-47090366 GGGGATGGGCAAGAAGGGGCTGG - Intergenic
1024294015 7:47828482-47828504 AGGAAAGGGCAAGGTGGGCCAGG + Intronic
1024389870 7:48796074-48796096 ACTGGAAGGCTAGATGGGGCTGG - Intergenic
1024920002 7:54545738-54545760 AGGGAAGGGAAAGAGAGGGCAGG + Intronic
1025020244 7:55474855-55474877 AGGCAATGGGAAGATGCGGCAGG + Intronic
1026102148 7:67392312-67392334 AGGAAAAGGGAAGATGGAGGGGG - Intergenic
1026141654 7:67712004-67712026 AGGGTGAGGCCAGATGGGGAAGG + Intergenic
1026216472 7:68353794-68353816 AGGGACAGTCAAGATAAGGCAGG + Intergenic
1026308806 7:69166214-69166236 AGGGGAAGGGAAGAGGGGGAGGG + Intergenic
1026308815 7:69166233-69166255 AGGGGAAGGGAAGAGGGGGAGGG + Intergenic
1026526317 7:71156475-71156497 AGGGAAAGGAAAGGCAGGGCAGG - Intronic
1027136053 7:75624679-75624701 CTGGAAAGGCAAGTGGGGGCCGG - Intronic
1027189364 7:75988638-75988660 AGGGGAAGGCCAGGTGGGGTGGG + Intronic
1027361733 7:77416411-77416433 GGGGAGAGGAAAGAGGGGGCGGG - Intergenic
1028836097 7:95376919-95376941 AGGGCAAGCCAAAGTGGGGCAGG + Intronic
1029306709 7:99625011-99625033 AAGGAAAGGCTAGGTGGGGTCGG - Intronic
1029401226 7:100347853-100347875 AGGTACAGGCAAGATGGGACAGG - Intronic
1029499769 7:100921500-100921522 AGGGAAAGGCAAGGTGGTGCAGG + Intergenic
1029585399 7:101467569-101467591 AAGAAAAGGGAAGATGGGGCCGG + Intronic
1031186029 7:118481373-118481395 ATGGAAAGGAAATGTGGGGCAGG - Intergenic
1031214791 7:118877080-118877102 AGGGAAGGGGAAGAAGGGGAAGG + Intergenic
1031595117 7:123640744-123640766 GGGGGAAGGCAAAAGGGGGCAGG + Intergenic
1031757203 7:125660124-125660146 AGGAACAGACAAGATGGTGCTGG + Intergenic
1033000005 7:137493198-137493220 AGGCAATGGCAACATAGGGCAGG - Intronic
1033174518 7:139112106-139112128 AGGGAAAGGAAAGAAGGGAAAGG + Intergenic
1033663569 7:143420805-143420827 GGTGAAAGGCAAGAAGGAGCAGG + Intergenic
1033870548 7:145749850-145749872 GGGGAAATGCAACATTGGGCAGG + Intergenic
1034181627 7:149143474-149143496 AGGGAAAGTCAAGATGCAGATGG + Intronic
1034282429 7:149863535-149863557 AGGGAAAGCCGAGAGAGGGCTGG + Intronic
1034843146 7:154418239-154418261 AGTGGCAGGCAAGGTGGGGCAGG - Intronic
1035167803 7:157002153-157002175 AGTGAAAGGCAACCTGGGGATGG - Intronic
1035235219 7:157493440-157493462 AGAGAAAGGCAAGTGGGGCCAGG + Intergenic
1037890675 8:22622357-22622379 TGGGAAATGCCAGGTGGGGCGGG + Intronic
1038618246 8:29115767-29115789 AGGGCAGGGCAGGACGGGGCAGG - Intronic
1038835519 8:31116956-31116978 AGGGAAAGACAATGTGGGGTAGG + Intronic
1039088797 8:33806264-33806286 AGGGAAAGGAAAAATAGGGAGGG - Intergenic
1039117498 8:34108574-34108596 AGGAACAGGCAACATGGTGCTGG - Intergenic
1039323253 8:36456375-36456397 AAGGAAAGACAAGTTGGGGAAGG - Intergenic
1039406780 8:37319616-37319638 AGTTAAAGGCAAGATGGAGTTGG + Intergenic
1039613838 8:38939198-38939220 AAGAAAGGCCAAGATGGGGCCGG - Intronic
1039620388 8:38991858-38991880 CAGGAAAGGCAAGACAGGGCAGG + Intronic
1039848524 8:41343150-41343172 AGGGATAGGGAAGTGGGGGCCGG + Intergenic
1040854229 8:51932270-51932292 GGGGGAAGGCAAGTTGTGGCAGG + Intergenic
1041077141 8:54178916-54178938 AGTGCTAGGTAAGATGGGGCAGG - Intergenic
1042317803 8:67442989-67443011 AGGGAAAAGAAGGATGGGGCTGG - Intronic
1042530534 8:69810316-69810338 AGGGCAAAGCAAGATGGTGGAGG + Intronic
1043829279 8:84968689-84968711 AGGGAAAGCCAAGAAGGGATTGG + Intergenic
1044812620 8:96079562-96079584 GCAGAAAGGCAAGATGGGTCGGG + Intergenic
1044982693 8:97732273-97732295 AAGGAAAGAAAAGATGGGGCCGG + Intergenic
1045311429 8:101006641-101006663 ACGGAGAGGCAAGATGTGGTAGG - Intergenic
1045734113 8:105275197-105275219 AGGGAGAGGAAAGTTGGGGCGGG - Intronic
1045788337 8:105952341-105952363 TGGGAAAGGGTAGGTGGGGCTGG - Intergenic
1046320374 8:112566757-112566779 AGGAGAAGGCAACATGGTGCAGG + Intronic
1046993271 8:120485917-120485939 AGGGAAAGGCAAAGTGAGTCAGG - Intronic
1047019603 8:120760797-120760819 ACAGGAAGGCTAGATGGGGCTGG - Intronic
1047053918 8:121143588-121143610 GGTTAAAGGCAAGATGGGGTGGG - Intergenic
1047221051 8:122918454-122918476 AGGCAAAGGCGAGATGGGTAAGG - Intronic
1047324624 8:123824598-123824620 AGGAAGAGGCAGGATGGGGGTGG - Intergenic
1048533852 8:135274348-135274370 AGGCAAAGGCAAGAGGTGGAAGG + Intergenic
1049109148 8:140632400-140632422 AGGGAAGGGGGAGAGGGGGCAGG + Intronic
1049164141 8:141116291-141116313 GGGGAAAGGGAAGACTGGGCCGG + Intergenic
1049222653 8:141434989-141435011 TGGGCAAGGCAAACTGGGGCTGG - Intergenic
1049236329 8:141514204-141514226 AGGGACAGGCCAGCTGAGGCTGG + Intergenic
1049783585 8:144439991-144440013 AGGGAAATGCAAGGTGCCGCTGG + Intronic
1050374754 9:4959229-4959251 AGGGATAGGCCATCTGGGGCGGG - Intergenic
1050498489 9:6268926-6268948 AGGGCAGGGCAAGACAGGGCAGG - Intergenic
1050501959 9:6307918-6307940 AGGGGAAGTCAAGAGGGGGAGGG + Intergenic
1051246712 9:15119098-15119120 AATGAAAAGGAAGATGGGGCTGG + Intergenic
1051893340 9:21965370-21965392 AGGGGAAGGGTAGATGGAGCAGG - Intronic
1052891130 9:33701304-33701326 AGGCAAGGGCAAGAGGGGGTGGG + Intergenic
1052915783 9:33923510-33923532 AGGAAGAGGCAAGCTGAGGCTGG + Intronic
1053358850 9:37468699-37468721 AGGGGAAGGCAAGGCAGGGCAGG + Intergenic
1055014603 9:71602623-71602645 AGGGAAAGGCAAGATGGGGAGGG - Intergenic
1055397720 9:75891932-75891954 AGGGGGAGGGAAGAGGGGGCCGG + Intronic
1055567844 9:77586792-77586814 AGGAACAGGCAACATGGCGCTGG - Intronic
1055652826 9:78423451-78423473 AGGGGAATGCAAGATGGAACAGG + Intergenic
1056422406 9:86441680-86441702 AAGGAAAGGAAAGAAGGGGCTGG - Intergenic
1056813448 9:89782211-89782233 ATGGAAATGCAAAATGGGGTTGG - Intergenic
1057004688 9:91546974-91546996 AGAGGAAGGCTAGAGGGGGCTGG - Intergenic
1057068306 9:92074902-92074924 AAGTAAAGGCAAAAAGGGGCTGG - Intronic
1057313172 9:93954183-93954205 AGGGAAAGACAAGACGAGGGTGG + Intronic
1057429324 9:94979864-94979886 AGGGACAGGGACCATGGGGCAGG - Intronic
1057820439 9:98326132-98326154 ATCCAAAGGAAAGATGGGGCCGG + Intronic
1057873595 9:98736167-98736189 AGGGAAAGGGACGATGGAGAAGG - Exonic
1058484227 9:105427226-105427248 AGGGAAAGAGAAGATAGGCCAGG - Intronic
1058817589 9:108699105-108699127 AGGGCAAGGCAGGGTAGGGCAGG + Intergenic
1059477000 9:114555287-114555309 TGGGAAAGGCAAAGTGGGGGCGG - Intergenic
1059598604 9:115750928-115750950 AGGGAAATGCAAGATAAGCCTGG + Intergenic
1060479364 9:124009006-124009028 AGGGAAAGGCAAGGGGTGGGGGG - Intronic
1060838093 9:126772966-126772988 AGAGGAAGGCAAGACAGGGCAGG + Intergenic
1061187063 9:129060873-129060895 AGGGAAAGGCCAGCACGGGCTGG - Intronic
1061212207 9:129200375-129200397 AGTGAAAGGGAAGATAGAGCAGG - Intergenic
1061237546 9:129351525-129351547 AGAGGAAGGGAAGAGGGGGCTGG + Intergenic
1061444129 9:130628210-130628232 AGGCCAAGGAAAGATGGGCCTGG - Intronic
1061464472 9:130766761-130766783 GGGGCAAGGCAGGGTGGGGCCGG - Intronic
1061885719 9:133590166-133590188 AAGGAAAGGAAAGAAGGGGAGGG - Intergenic
1061907295 9:133705229-133705251 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907308 9:133705278-133705300 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907321 9:133705327-133705349 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907334 9:133705380-133705402 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907347 9:133705433-133705455 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1061907370 9:133705531-133705553 AGGGTGAGGGCAGATGGGGCAGG - Intronic
1062707868 9:137955180-137955202 AGGGACAGGGAAGAAGGGACTGG - Intronic
1203563389 Un_KI270744v1:75192-75214 AGGGACAGGGATGGTGGGGCTGG + Intergenic
1203657958 Un_KI270753v1:16533-16555 AGGGAAAGTCATGAGGGAGCTGG + Intergenic
1186032184 X:5380313-5380335 AGGGAAAGGCAGGATGGGGGTGG - Intergenic
1186327812 X:8498735-8498757 AAGGAAAGGAAAGAGGGGGAGGG + Intergenic
1186718524 X:12278577-12278599 AGGGAAGGGCAAGATAGGGGAGG + Intronic
1187579966 X:20596875-20596897 AGGGAGAGGCAAGAAGTGGAAGG + Intergenic
1187700430 X:21959921-21959943 AGGAGCAGGCAAGAAGGGGCCGG + Intronic
1187797499 X:23020384-23020406 AGGGAATAGCAAGAGGGTGCAGG + Intergenic
1189314471 X:40044832-40044854 TGGCAAAGGCGAGATGGGTCAGG - Intergenic
1189468685 X:41297737-41297759 AAGAAAAGGGAAGTTGGGGCCGG + Intergenic
1189500305 X:41550229-41550251 TGGAAAATGCAAGATGGGGGTGG - Intronic
1189618471 X:42810403-42810425 AAGAAAGGGCCAGATGGGGCCGG + Intergenic
1190455092 X:50619319-50619341 AGGGAAAGGCGAGACGGGTTGGG - Intronic
1190714115 X:53089501-53089523 TGGGATTGGCAAGATGGGGGCGG + Intergenic
1192450884 X:71244229-71244251 GGGGAAAGGGGAGAAGGGGCTGG - Intronic
1192691787 X:73372804-73372826 AGGGAAAGGAACAAAGGGGCTGG - Intergenic
1192798450 X:74443859-74443881 AGGAAAAGGTATGATGGGGCGGG - Intronic
1194523799 X:94950908-94950930 AGGAAAAGGCAAGATGGGGAGGG + Intergenic
1194641183 X:96405911-96405933 AGGGAAAGGCAAGATAGGGAAGG - Intergenic
1195616385 X:106915859-106915881 AGGGAAACACTAGATGGGTCTGG - Intronic
1196202739 X:112903935-112903957 TGTGAAAGGCTAGACGGGGCAGG - Intergenic
1196723059 X:118872747-118872769 AGGGAAAGGAAAGGTAGGGAGGG - Intergenic
1197352156 X:125392912-125392934 AGGGAGAGGTCAGATGGGTCTGG + Intergenic
1197926473 X:131651961-131651983 TGGGAAGGGCAATAGGGGGCTGG - Intergenic
1198073190 X:133169825-133169847 AGGGAAAGGCAAGATGGGGGTGG - Intergenic
1198133829 X:133727010-133727032 AGGGAAAGGCAATAAGGGAAAGG + Intronic
1198224210 X:134630587-134630609 AAGGGCGGGCAAGATGGGGCAGG + Intronic
1198533097 X:137564103-137564125 AGTGAAAAGAAAGGTGGGGCGGG + Intergenic
1198753191 X:139955592-139955614 AAGAAATTGCAAGATGGGGCCGG - Intergenic
1198871750 X:141183126-141183148 TGGGAAAGGCAAGGCAGGGCAGG - Intergenic
1199170163 X:144726192-144726214 AGGCAAAGTCAGGAGGGGGCTGG - Intergenic
1199669239 X:150128244-150128266 ACAGAAAGGCAAGCTGAGGCCGG - Intergenic
1199765991 X:150941988-150942010 AGGCAAAGGGAAGAGGGGGAAGG + Intergenic
1199876088 X:151929529-151929551 ACCGAAAGCCAAGATGGGCCAGG + Intergenic
1200329021 X:155274836-155274858 GGGGAAATACAAGATGGGCCTGG - Intergenic
1201966175 Y:19738883-19738905 AGGGAAAGGCAAGACAGAGCAGG - Intronic
1202584556 Y:26409349-26409371 AGGTAAGGCCAAGATGGGGCCGG + Intergenic