ID: 1009590161

View in Genome Browser
Species Human (GRCh38)
Location 6:65658376-65658398
Sequence TAGTTGCAACAGATGTATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009590161 Original CRISPR TAGTTGCAACAGATGTATCA TGG Intronic
902160387 1:14525384-14525406 TAGTTGCAACAGACACCTCATGG - Intergenic
907063437 1:51454805-51454827 TAGTTTTGACAGATGTACCATGG + Intronic
907115627 1:51965830-51965852 TAGTTTTGACAAATGTATCATGG + Intronic
910134383 1:83950122-83950144 TAGTTACAACAGTTTTATCTAGG + Intronic
914254480 1:145950225-145950247 CAATTGCAAGAGATTTATCAGGG + Intronic
914773328 1:150712033-150712055 TAGTAGCAATAGATATTTCAGGG - Intronic
921313344 1:213867576-213867598 TAGTTCCAACAGCAGTGTCAAGG - Intergenic
1063611575 10:7567265-7567287 TAGGTACAAAATATGTATCAGGG - Intronic
1065344133 10:24732867-24732889 TAGTTGCAACAGAGGTCGCGTGG - Intergenic
1069182032 10:65373870-65373892 GAGTTGCAACAGCTGTAGAATGG - Intergenic
1074901783 10:117823103-117823125 TAGTTTAGACAGATGTGTCATGG + Intergenic
1075850566 10:125583174-125583196 AATTTACAACATATGTATCAGGG - Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1080876634 11:36280599-36280621 CAGTGTCAACAGATGTTTCAAGG + Intronic
1086267350 11:85017067-85017089 TAGTTGCTACAGATATCTTATGG + Intronic
1088011777 11:105011561-105011583 TAGTTCCAACAGATTTTTCATGG - Intronic
1092175400 12:6401678-6401700 TAGTTTTGACAAATGTATCATGG - Intergenic
1095715425 12:45341076-45341098 TACTTAAAACAGTTGTATCAAGG - Intronic
1098228762 12:68351604-68351626 TAGTTCCAAGAGATGTTTCTAGG + Intergenic
1098600920 12:72330880-72330902 TTGTTGCAACACAGGTATCTGGG + Intronic
1098850240 12:75587567-75587589 TTGTTGCAACAGATTCCTCAGGG - Intergenic
1100203778 12:92326620-92326642 TAGTTCCAACAAATGTAGCATGG - Intergenic
1100959006 12:99942277-99942299 TATTTGCAACAGAGAAATCACGG + Intronic
1101308069 12:103550874-103550896 TGCTTGCAACAGATATAACAAGG - Intergenic
1102183091 12:110927473-110927495 TTGTTGTAACCGATGTATTAGGG - Intergenic
1105395864 13:20033806-20033828 TAATAGTAACAGATGTATCATGG - Intronic
1105570599 13:21599303-21599325 TAATTTCAAAAAATGTATCAAGG + Intronic
1106655424 13:31739886-31739908 TAGATGCAACAAATTTTTCATGG + Intronic
1106778521 13:33032242-33032264 TAATGGGAACAGATGTATCTGGG - Intronic
1108437191 13:50412018-50412040 TACTTGAAAGAGATGTACCAGGG - Intronic
1109056337 13:57553871-57553893 TTGTTGCAATATATGTATTATGG - Intergenic
1110234934 13:73207125-73207147 TGGTTTTAACAAATGTATCATGG + Intergenic
1112535089 13:100246054-100246076 TAGTTGATACAGGTGTATAAAGG - Intronic
1112787082 13:102962976-102962998 TACTTGTGACAAATGTATCATGG - Intergenic
1113868487 13:113544099-113544121 CAGTTCCAACAGATGTGTCCGGG + Intronic
1114392383 14:22323936-22323958 TGGTTGCAAAAGAAATATCAGGG - Intergenic
1116429797 14:44832859-44832881 TATTTGCAAAAAATGTATCAAGG - Intergenic
1119656120 14:76418383-76418405 TAGTTGTGACAAATCTATCATGG - Intronic
1120017861 14:79494771-79494793 TAGTTTCAAACCATGTATCACGG - Intronic
1125632225 15:41156602-41156624 TAGTTTTTACAGATGTATCATGG + Intergenic
1127709342 15:61579991-61580013 TAGTTTTGACAAATGTATCATGG - Intergenic
1130083212 15:80753439-80753461 TAGTTTTGACAGATGTATCACGG + Intronic
1130873166 15:87988457-87988479 TACTTGTGACAAATGTATCATGG + Intronic
1135716176 16:24770130-24770152 TATTTGCAAGAAAGGTATCAAGG + Intronic
1137644471 16:50062121-50062143 TGGTTGTAACAAATGCATCATGG - Intergenic
1138221350 16:55254147-55254169 TAGATGTAACAAATGTCTCATGG + Intergenic
1140950391 16:79811286-79811308 TATTTGCAACAGAAGTTTGATGG - Intergenic
1142501963 17:338119-338141 TAGGTGGAACTGCTGTATCAAGG + Intronic
1146550639 17:33777524-33777546 TTGTTCAAACAGATGTGTCATGG - Intronic
1148258859 17:46161557-46161579 TACTTACAAGAGATGTATCCTGG - Intronic
1150511746 17:65759863-65759885 TACTTACAACAGATTTATCGGGG - Intronic
1151112486 17:71695514-71695536 TAGTTGAACCAGGTGTATGATGG + Intergenic
1153134062 18:1893092-1893114 TAGTTTCAACAAATGTGCCATGG + Intergenic
1153207816 18:2722050-2722072 TATTTGCAACATGTGTAACAAGG - Intronic
1157176011 18:45453045-45453067 TGGTTGCACCAGTTGTCTCAAGG - Intronic
1158164207 18:54520620-54520642 CAGCTGCAACATAGGTATCAGGG - Intergenic
1162305972 19:9874064-9874086 TAGTTGTGACAAGTGTATCATGG - Intronic
1166540361 19:43601250-43601272 TAGTTGCAACAGAGATTTTAAGG + Intronic
1202634280 1_KI270706v1_random:29897-29919 TAGTTGGTACAGCTGTATGAAGG - Intergenic
927121436 2:19967823-19967845 TAGTTGTGACAAATGTACCATGG - Intronic
930726831 2:54690343-54690365 TAGTTGCAAAAGAAGTGTAAAGG + Intergenic
931117210 2:59178046-59178068 TAGTTGCAACAGAAATTCCATGG - Intergenic
935040958 2:99426720-99426742 TAGTTGTAATAGATGAGTCACGG - Intronic
935379640 2:102438638-102438660 TAGATGCAACAGATGTTGCAAGG - Intronic
935806817 2:106757005-106757027 TAGTTGGAAGTGATGTTTCAGGG + Intergenic
937962916 2:127475873-127475895 TTTTTGCAACATATTTATCAGGG - Intronic
940793859 2:158056311-158056333 TAATTGTAACAAATGTACCATGG - Intronic
940844606 2:158625990-158626012 AAGTTGGAACAGCTGTATTAGGG - Intronic
942649553 2:178152270-178152292 TAGTTGCAACAGAAGTTGTACGG + Intergenic
943755144 2:191549635-191549657 TAGTTGCTACAGATATTACATGG + Intergenic
943855395 2:192783760-192783782 TAGTTGCAACAGAGATTTTATGG + Intergenic
943926206 2:193783746-193783768 AAGTTGTAACATATGTATAATGG + Intergenic
943993015 2:194721478-194721500 GAGCTGCAAGAGAGGTATCAAGG + Intergenic
943996468 2:194772498-194772520 TAATTGTAACAGATGAAACATGG + Intergenic
944429032 2:199613586-199613608 TGTTTGGAACAGATATATCAAGG - Intergenic
948376240 2:237522322-237522344 TAGTTGTAACAGGTGTTTGAAGG - Intronic
948376280 2:237522566-237522588 TAGTTGTAGCAGGTGTTTCAAGG - Intronic
948376289 2:237522627-237522649 TAGTTGCAGCAGGTGTTTGAAGG - Intronic
1169882095 20:10357914-10357936 TAGTTGCAGCAGAGATCTCATGG + Intergenic
1170343158 20:15351920-15351942 TGTTTGTACCAGATGTATCAGGG - Intronic
1170374768 20:15688423-15688445 TATTGACAGCAGATGTATCAGGG + Intronic
1175511506 20:59530415-59530437 TAGTTGCAAAAGACATATAAAGG + Intergenic
1175673130 20:60923328-60923350 TAATTGTGACAAATGTATCATGG - Intergenic
1176895513 21:14373932-14373954 TATTTGAAACAGAAATATCACGG - Exonic
1177022302 21:15877136-15877158 TAGTTGCAACAGAAACTTCATGG + Intronic
1177240986 21:18456776-18456798 GAGTTTGAACATATGTATCAAGG - Intronic
1177333820 21:19697832-19697854 TAGTTGAGACAAATGTAACAGGG + Intergenic
1177718198 21:24867437-24867459 TATGTACAAAAGATGTATCAGGG - Intergenic
1177925097 21:27204153-27204175 TATGAGCAAAAGATGTATCATGG - Intergenic
1178071694 21:28975513-28975535 TAGTTGCAACAGAGATGACATGG - Intronic
1178490152 21:33045183-33045205 TAGTTGTGACAAATGTACCAAGG - Intergenic
1179772942 21:43637415-43637437 TAATTGCAACAGATATGTGATGG + Intronic
1180080402 21:45484610-45484632 TATGTGCAACACATGTATCTGGG + Intronic
1182581933 22:31319083-31319105 CAGTTGCAACAGATTTATTGGGG - Intergenic
1183707809 22:39485380-39485402 TAGTTGTGACAAATGTACCATGG + Intronic
950192041 3:10983852-10983874 TAGTTGCAACAGAGATCTTACGG + Intergenic
953041235 3:39256646-39256668 TATTTACAACATATTTATCATGG - Intergenic
954883761 3:53854294-53854316 TAGTTTTGACAAATGTATCATGG - Intronic
955048492 3:55385011-55385033 TAGTTGTGACAAATGTATCATGG + Intergenic
955248514 3:57252670-57252692 TAGTGGCAGCAGATGTGACATGG + Intronic
955867088 3:63396600-63396622 TAGTTTGAAAAGATGTATGATGG + Intronic
956193387 3:66628718-66628740 TAGTTGCAGCAGAGGCCTCATGG + Intergenic
957966232 3:87324627-87324649 TAGTTGCACCAGCTCCATCAGGG + Intergenic
961529981 3:127534488-127534510 TAGTTCTGACAGTTGTATCACGG + Intergenic
962382140 3:134906646-134906668 TAGTTGCAACAGAGATCTTATGG + Intronic
963229779 3:142897691-142897713 TAGTTGCAAAAGATCTATATGGG + Intergenic
966057091 3:175707198-175707220 TAGTTGCAACAGATAGCACATGG - Intronic
966280090 3:178215877-178215899 TAGTTGCGACAAATGTACCAGGG + Intergenic
966302258 3:178492867-178492889 TAGTAGTAACATATGTATCAAGG + Intronic
970403552 4:15740903-15740925 TAGTTGCGACAGAGGTTGCATGG - Intergenic
971154874 4:24070920-24070942 TAGTTGCAACAGAGGCCTTATGG + Intergenic
971524763 4:27603141-27603163 TAGTTGCACCAAATTTAGCAAGG + Intergenic
972369726 4:38411270-38411292 TAGTTGCAAGAAATGCCTCAAGG - Intergenic
972632053 4:40850670-40850692 TAGTTGCAACAGAGGCCACATGG + Intronic
974622254 4:64373341-64373363 TAGTTTCAATAGTTATATCAGGG - Intronic
977883409 4:102232898-102232920 TAGTTCTAACAGATGAAACATGG + Intergenic
980034506 4:127868376-127868398 TACTTGCAACAGTTTTATTATGG - Intergenic
980965911 4:139521043-139521065 TAGTTGCAACAGATATTATATGG + Intronic
981874870 4:149529968-149529990 TAGCTGGAACAGATGGATCAAGG - Intergenic
983611308 4:169648241-169648263 TAGTTTTGACAAATGTATCATGG + Intronic
986749358 5:10772704-10772726 TAGTTGCAACAGAGGTGGCATGG + Intergenic
987669254 5:20986100-20986122 TAGTTGCAACAGAGGCTACATGG + Intergenic
989954884 5:50346837-50346859 TAGTTGCAACAGAGATAATATGG - Intergenic
995457265 5:112365593-112365615 TAGTTGTAACAAACGTACCATGG - Intronic
998981993 5:147714377-147714399 TAGGTGTAACAGAAGAATCAGGG + Intronic
1002318773 5:178362666-178362688 TAGTTCCAACAGAAGTCCCATGG - Intronic
1002383378 5:178847065-178847087 TAGTTGCAACAGAGATCACATGG - Intergenic
1003322645 6:5065789-5065811 TAGTTGCTACATATTTACCAGGG + Intergenic
1005221203 6:23590989-23591011 AAGTTGTAACAGATGGAACAGGG - Intergenic
1009590161 6:65658376-65658398 TAGTTGCAACAGATGTATCATGG + Intronic
1009740413 6:67735996-67736018 CAGATGCAACATATGTATTATGG - Intergenic
1011073861 6:83416959-83416981 TACATGCCACAGATGTAACATGG - Intronic
1011976132 6:93301795-93301817 TTGTGGTAACTGATGTATCAAGG - Intronic
1016971283 6:149766649-149766671 TAGTTGCAACAGAGATTACACGG + Intronic
1017399557 6:154044845-154044867 TAGTTGAAACAGATATTTTAAGG + Intronic
1021548601 7:21844515-21844537 TAGTTGCAACAGATACCTTATGG + Intronic
1024602916 7:51000884-51000906 TAGCTACAGCAGATGTGTCAGGG + Intergenic
1028195736 7:87905207-87905229 TAGTTGCAACAGAGATCTTACGG - Intronic
1028447124 7:90937668-90937690 TAGTTGCAACAGAGACTTCATGG - Intronic
1029010403 7:97254892-97254914 TAAGTTCAACAGATCTATCATGG + Intergenic
1029055698 7:97739336-97739358 TAGTTGCAACAGAGATTACATGG - Intronic
1030135906 7:106247752-106247774 TAGTTGCAACAGAGAAATTATGG - Intergenic
1032424709 7:131813131-131813153 TAGCTGCAACAGAAATAGCATGG + Intergenic
1032822271 7:135535054-135535076 TAGTCTCTACAGATGTCTCAAGG - Intergenic
1034701060 7:153096394-153096416 TTGTTGTAAAAAATGTATCAAGG + Intergenic
1036285074 8:7437089-7437111 TAGTTGCAACAGAAGCCACATGG - Intergenic
1036336402 8:7874440-7874462 TAGTTGCAACAGAAGCCACATGG + Intergenic
1040920429 8:52610693-52610715 TAGTTACACCAGATGCATCAGGG - Intergenic
1041683314 8:60616125-60616147 TAGTTGTACCAGATGAATTAAGG - Intronic
1044469068 8:92544335-92544357 TAGTTGTAACAGATCTTTCACGG - Intergenic
1044780656 8:95740363-95740385 TAGTTTCCACATCTGTATCATGG + Intergenic
1047059058 8:121202638-121202660 TAGTTGCCACAGAGGTAGCTGGG - Intergenic
1047674647 8:127187070-127187092 TTGTTGCAGCAGAAGTATTATGG - Intergenic
1047826678 8:128583880-128583902 CAGTTGCAACAGAGGCCTCAAGG - Intergenic
1048222476 8:132554387-132554409 TAGCTGCAACAGATTTCCCATGG - Intergenic
1048931902 8:139321847-139321869 TAGTGGCATCAGATTTCTCACGG - Intergenic
1050497292 9:6257346-6257368 CAGGTGCAAAAGATATATCAAGG - Exonic
1051051443 9:12937101-12937123 TAGGTACAAGAGATGTATTAGGG + Intergenic
1051293209 9:15566940-15566962 AATTTTCAACAGAAGTATCAAGG - Intronic
1051346853 9:16159373-16159395 TAGATGCAAAAGATGTATTCAGG - Intergenic
1053362327 9:37497625-37497647 TAGTTGCAACAGAGGTTGTATGG + Intronic
1056689537 9:88794953-88794975 TAATTCCAACATGTGTATCATGG - Intergenic
1059195982 9:112371425-112371447 GAGTTGAAACAGATGAATTAGGG - Intergenic
1059679769 9:116574766-116574788 CAGTTTCATCAGATGTATCAGGG + Intronic
1186156131 X:6728733-6728755 TCGTTGCAACAAATGTGCCATGG - Intergenic
1186345846 X:8692325-8692347 TAGTTGCAACAGATACTTTATGG + Intronic
1187116196 X:16353990-16354012 TAGTTGCAACAGACATCTTATGG + Intergenic
1187921845 X:24211115-24211137 TAGGTGCAAGAGATGTAGAAAGG + Exonic
1189608635 X:42707127-42707149 TAGTTTAAATAGATGTACCATGG - Intergenic
1190562309 X:51697480-51697502 TAGATGTTGCAGATGTATCACGG + Intergenic
1193180828 X:78454522-78454544 TATTTGAAACAGATGTTTCGGGG - Intergenic
1194267354 X:91771315-91771337 AAGTTGAAAGAGATGTAGCATGG + Intergenic
1197292990 X:124682971-124682993 TAGTTGTGACAAATGTACCATGG + Intronic
1199726442 X:150587397-150587419 TAGTTGCAACAGAAATGTCTGGG + Intronic
1200584558 Y:4992252-4992274 AAGTTGAAAGAGATGTAGCATGG + Intergenic
1201549602 Y:15206218-15206240 TCGTTGCAACAAATGTGCCATGG - Intergenic