ID: 1009591126

View in Genome Browser
Species Human (GRCh38)
Location 6:65672493-65672515
Sequence TGGAGCTGGTCCACAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009591121_1009591126 23 Left 1009591121 6:65672447-65672469 CCGCAAAATATGTAGCTGGGTCA 0: 1
1: 0
2: 0
3: 22
4: 205
Right 1009591126 6:65672493-65672515 TGGAGCTGGTCCACAAATACTGG 0: 1
1: 0
2: 1
3: 17
4: 107
1009591120_1009591126 24 Left 1009591120 6:65672446-65672468 CCCGCAAAATATGTAGCTGGGTC 0: 1
1: 1
2: 6
3: 38
4: 225
Right 1009591126 6:65672493-65672515 TGGAGCTGGTCCACAAATACTGG 0: 1
1: 0
2: 1
3: 17
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009591126 Original CRISPR TGGAGCTGGTCCACAAATAC TGG Intronic
903757019 1:25669459-25669481 TGGAGGTGCTCAATAAATACTGG + Intronic
908663946 1:66468235-66468257 TGGAGCTGGTGTACAAACTCAGG + Intergenic
909155238 1:72066241-72066263 TGGAGCTGGGATACAAATCCAGG + Intronic
909346705 1:74597475-74597497 TATAGCTGGTTCACAAATATTGG - Intronic
921460785 1:215423944-215423966 TGGAGCTGGGCTGCAAATCCAGG - Intergenic
921987683 1:221329880-221329902 TGGAGCAAGTCCACAAAGATTGG + Intergenic
1064267077 10:13833838-13833860 TGGAGCTGGGCCTCAAAGCCAGG + Intronic
1066102604 10:32131323-32131345 TGCTGCTGGTTCACAAATACTGG - Intergenic
1068194439 10:53697723-53697745 TGGAACTGGTTCTCAAATATAGG + Intergenic
1072482661 10:95824601-95824623 TGGAGCTGGTAAACAAATAATGG - Intronic
1073143924 10:101266762-101266784 TGGTTCTGGCCCACAGATACAGG + Intergenic
1075904839 10:126072203-126072225 TGGAGGTGATCCAGAAATGCAGG + Intronic
1077945530 11:6893444-6893466 TGGAGCTGTTCCAAAAAGAAGGG + Intergenic
1080077806 11:28172248-28172270 TGGAGCTGATCTATAAAGACAGG + Intronic
1080898694 11:36467302-36467324 TGGAGTCTGTACACAAATACAGG - Intergenic
1091379563 12:47698-47720 TGGAGCTGGTCCACAAGCTCAGG + Intergenic
1091770215 12:3146445-3146467 AGGAGGTGCTCCACAGATACTGG - Intronic
1094190040 12:27688795-27688817 TAGAGCTGGTCCTGAAATCCAGG - Intronic
1094747916 12:33367893-33367915 TGGAGCTGGGCCTCAAATCTAGG - Intergenic
1095574625 12:43722131-43722153 TACAGCTGTTTCACAAATACAGG - Intergenic
1098560657 12:71867823-71867845 TGAAGCTGGTGCACAAATTTTGG + Intronic
1099871280 12:88352276-88352298 CAGAGCTGGTCCACAATCACTGG - Intergenic
1102661786 12:114535300-114535322 TTCAGCTGGGCCACAAGTACTGG - Intergenic
1103206719 12:119135312-119135334 TGGAGCTGGGCCAAAGATAATGG + Intronic
1109488112 13:63055452-63055474 TGGAACTGTTCTACATATACTGG + Intergenic
1115255791 14:31400449-31400471 GGGAGCTGTTCAACAAAGACAGG + Exonic
1117896188 14:60489627-60489649 AGGAGATGGTACTCAAATACAGG - Intronic
1118690947 14:68339221-68339243 TTAAGCTGGCCCACAAGTACAGG - Intronic
1118888334 14:69885832-69885854 TTAAGCTGGCCCACAAGTACAGG - Intronic
1120716602 14:87847334-87847356 TGGGGCTGGTGAACAAATACAGG + Intronic
1132052138 15:98615994-98616016 TGGAGAAGCTGCACAAATACAGG - Intergenic
1133051926 16:3121856-3121878 GGGAGCTGGGCCACAAATATGGG - Intergenic
1138128948 16:54462294-54462316 TGGAGCTGGCCCAAAAAGAATGG + Intergenic
1139697742 16:68687223-68687245 TGAAGCTGATCGACAAACACTGG + Intronic
1141624463 16:85253996-85254018 TGGAGCTGGAGCAAAAATAGAGG + Intergenic
1142974985 17:3637919-3637941 TGGAGAGGGTACACAAATAGTGG - Intronic
1143262461 17:5609866-5609888 GGGCGCTGGTCCTCAAATGCAGG - Intronic
1146589789 17:34118841-34118863 TGAAGCTGCTCCAGAAATTCAGG - Intronic
1147621749 17:41872725-41872747 TGGAGCATAGCCACAAATACAGG - Intronic
1152365219 17:79851719-79851741 TGAAGCTGGTCCACCCGTACGGG + Intergenic
1157886462 18:51371437-51371459 TGGAGCTGTTGCACAAATTCAGG + Intergenic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1167666733 19:50826777-50826799 TGGAGCAGATCCATAAATTCCGG + Intronic
1202675109 1_KI270710v1_random:36587-36609 TGGAGGTGGATCACCAATACTGG - Intergenic
925359650 2:3268388-3268410 TGGAGCTGGTCCACAGTCGCTGG - Intronic
926428276 2:12759696-12759718 TGGAGCTGACCCTAAAATACAGG + Intergenic
926786802 2:16525894-16525916 TGGAGCTAGTCCACAGATACTGG - Intergenic
927363888 2:22271684-22271706 TTGGGCTGCTCCACAAATTCTGG + Intergenic
928229151 2:29481068-29481090 TGAAGCTGGTCCTCAAACACAGG - Intronic
929711102 2:44267414-44267436 TGGAGCTGGGCCTCAAAGACAGG + Intergenic
935115770 2:100135085-100135107 TGGAGCAGTACCACAAATAAGGG + Intronic
935473888 2:103494299-103494321 TGGAGGTGGTACAGAACTACTGG + Intergenic
935639162 2:105274442-105274464 TAGAGCTGGGACACAAATCCAGG - Intronic
936564295 2:113571127-113571149 TGGAGCTGGTCCACAAGCTCAGG - Intergenic
937830812 2:126420988-126421010 CAGAGCTGGTTCACAAAGACTGG - Intergenic
938874537 2:135518743-135518765 TGGAGCTGGGTCACAAACTCAGG + Intronic
944308653 2:198206894-198206916 TGGTGCTGGTACAAAAAAACAGG - Intronic
944815184 2:203369043-203369065 TGGGGCTGGTCCTGAAATCCTGG + Intronic
945021878 2:205581896-205581918 TGGAGATGGTCCACAGAGCCTGG + Intronic
947314190 2:228837130-228837152 AGGTGCTGGTCCACTTATACAGG - Intergenic
947917683 2:233844744-233844766 AGTCGGTGGTCCACAAATACAGG + Intronic
948180089 2:235972811-235972833 TGTTGGTGGTCCACAAACACAGG + Intronic
1176636843 21:9253578-9253600 TGGAGGTGGATCACAAATACTGG + Intergenic
1177150343 21:17449493-17449515 TGGGGGAGGTCCCCAAATACTGG + Intergenic
1182191744 22:28468240-28468262 TGCAGCTGATCTACAAATGCTGG + Intronic
1183377625 22:37474249-37474271 TTGATCTGGTCCTCAAATGCCGG - Intronic
949518615 3:4829401-4829423 TGGGGCTGGCCAACAAATTCCGG + Intronic
952386323 3:32843884-32843906 TGGAGCTCCTCCACAAAGGCAGG - Intronic
954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG + Intronic
956483377 3:69695542-69695564 TGGAGCTGTTCCACAAAATCTGG + Intergenic
957081774 3:75642163-75642185 TGGAGCTGGTCCACTTAAATGGG - Intergenic
957764193 3:84600397-84600419 TGGAACTGGTCCAGAACTACTGG + Intergenic
960482806 3:118213879-118213901 TGGAGCTGATGAACAAATTCAGG - Intergenic
962642728 3:137404796-137404818 AGAAGCTGGTCCTCAATTACGGG - Intergenic
962992641 3:140593019-140593041 TGGAGCTGGTGCAGCAATATGGG - Intergenic
963412727 3:144952390-144952412 TTGAGCTAGTCTACAAATAGTGG - Intergenic
964285672 3:155115275-155115297 TGGTGGTGGTACACAAATCCTGG - Intronic
966774073 3:183528679-183528701 TGGAGCTGGTGTTCAAATCCTGG - Intronic
967794067 3:193579340-193579362 TCGAGCAGGTCCACCACTACTGG - Intronic
1202750052 3_GL000221v1_random:151441-151463 TGGAGGTGGATCACAAATACTGG - Intergenic
971843567 4:31888792-31888814 TAGAGCTGGTTTACAAAAACTGG + Intergenic
974740571 4:66001344-66001366 TGGAGATGGACAATAAATACAGG + Intergenic
979452540 4:120889836-120889858 TGGAGCTGGTGAACTAATGCAGG - Intronic
980389775 4:132128207-132128229 TGGAGCTAGCCAATAAATACTGG - Intergenic
980923221 4:139108522-139108544 TGGAGCAGGTCCAGAAACCCTGG - Intronic
980933168 4:139200773-139200795 TGGAGCTGGGACAAGAATACGGG - Intergenic
981351835 4:143739165-143739187 TGAAGCTGGTCCCCAATTCCTGG + Intergenic
1202751728 4_GL000008v2_random:12020-12042 TGGAGGTGGATCACCAATACTGG + Intergenic
988809781 5:34773066-34773088 TGGATATGTTCCACAAATAAAGG - Intronic
992717881 5:79529582-79529604 TTAAGCTGGCCCACAAGTACAGG + Intergenic
1000768090 5:165317030-165317052 TGGAGCTGGTGGACAAAGACAGG + Intergenic
1000931176 5:167253305-167253327 TGAAGCTGGTCCCAAACTACTGG + Intergenic
1002417405 5:179127708-179127730 TGAAGCAGGCCCACAAATACAGG + Intronic
1002542005 5:179912601-179912623 TGGACCTGGGCCACACCTACTGG + Intronic
1004906184 6:20239095-20239117 TCGCGCTGGCCCACAAGTACCGG - Intergenic
1005648380 6:27864262-27864284 TGAAGCAGGTCCACCAACACCGG - Intronic
1009591126 6:65672493-65672515 TGGAGCTGGTCCACAAATACTGG + Intronic
1012507076 6:99959394-99959416 TGGAGCCAGTCTACAAAGACTGG + Intronic
1015345764 6:132156436-132156458 TGGAGCTGGTCTACAACTTTTGG + Intergenic
1016604628 6:145906089-145906111 GAGTGCTGGTCCACAAATGCAGG + Intronic
1017994534 6:159520768-159520790 TGTTGCTGGTCCAAAAACACTGG + Intergenic
1021073452 7:16272445-16272467 TGGAGCTGCTCAACACATAATGG - Intronic
1029149392 7:98469390-98469412 TGGAGCTGGCCCACAGCCACAGG - Intergenic
1031042597 7:116854573-116854595 TGGAGCTTATCCTCAAAGACAGG + Intronic
1034079282 7:148261608-148261630 TGGAGCTGGTCCGGAATTGCTGG + Intronic
1038434450 8:27525438-27525460 TAGAGCTGGTAATCAAATACTGG - Exonic
1041183822 8:55277107-55277129 AGGAGCTGGTACATAAATCCTGG - Intronic
1041783634 8:61606965-61606987 TTGAGCTGGTCCTCAAGTAGTGG - Intronic
1043163607 8:76875494-76875516 TGGAGCTGGTTCACAGTCACAGG - Intergenic
1043860591 8:85311777-85311799 TGGACTTGTTCCATAAATACAGG + Intergenic
1049715025 8:144085741-144085763 TGGGGCTGATCCATACATACCGG - Exonic
1049888226 9:42977-42999 TGGAGCTGGTCCACAAGCTCAGG + Intergenic
1050036842 9:1445220-1445242 TGCTGCTGTTCCACAAAGACTGG + Intergenic
1053375761 9:37605038-37605060 TGGAGCTGGAATACAAATCCAGG + Intronic
1054973086 9:71111702-71111724 TTGTGCTAGTCCACAAATAAAGG - Intronic
1056970461 9:91196605-91196627 TGGAGCTGGTCTACAGGGACAGG + Intergenic
1060689349 9:125642840-125642862 TGGAGGAGGTCCCCAAATGCTGG - Intronic
1060975678 9:127763682-127763704 TGGACCTCCTCCTCAAATACAGG + Intronic
1061685834 9:132277067-132277089 TGGAGATGGTTCAGAAAGACGGG - Exonic
1203718696 Un_KI270742v1:181531-181553 TGGAGGTGGATCACAAATACTGG - Intergenic
1191123242 X:56927284-56927306 TGCTGCTGGTCCAAAAACACTGG + Intergenic
1192252913 X:69428176-69428198 TGGAGTTGGTCCAGAAATTTCGG - Intergenic
1193888767 X:87017217-87017239 TGGAGCTGTCCCACACATAAAGG - Intergenic
1196403907 X:115344802-115344824 TGGAGCAGGGCTACAAATTCAGG + Intergenic
1197808260 X:130417535-130417557 TGGTGGTGGTCCAAGAATACAGG - Intergenic
1201172854 Y:11286364-11286386 TGGAGGTGGATCACCAATACTGG - Intergenic