ID: 1009591228

View in Genome Browser
Species Human (GRCh38)
Location 6:65673330-65673352
Sequence GTGGTAAGAGGCAATATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1085
Summary {0: 2, 1: 6, 2: 37, 3: 602, 4: 438}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009591225_1009591228 -8 Left 1009591225 6:65673315-65673337 CCGAAGGAAGATTTTGTGGTAAG 0: 5
1: 1
2: 2
3: 17
4: 184
Right 1009591228 6:65673330-65673352 GTGGTAAGAGGCAATATTGTGGG 0: 2
1: 6
2: 37
3: 602
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009591228 Original CRISPR GTGGTAAGAGGCAATATTGT GGG Intronic
900721811 1:4181151-4181173 GTGGTAAGGAGTGATATTGTGGG + Intergenic
900841532 1:5052443-5052465 GTGGTAAGGAGTGATATTGTGGG - Intergenic
900847877 1:5118236-5118258 GTGGTAAGGGGTGATATTGTGGG - Intergenic
901092497 1:6651337-6651359 GTGGGAAGAGGCAGGATTGAGGG - Intronic
901589101 1:10324488-10324510 GTCATAAGGGGGAATATTGTAGG - Intronic
901947213 1:12713525-12713547 GTGGTAAAGGGCAATATTGTGGG - Intergenic
902051458 1:13566910-13566932 GGGGTAAGGGGTAATATTGTGGG - Intergenic
902187601 1:14737045-14737067 GTGGCAAGAGGGAATATTGCAGG + Intronic
904394351 1:30208526-30208548 GGGGTAAGGGGTGATATTGTGGG - Intergenic
904996097 1:34632570-34632592 GTGGTAAGGGGTGATATTGTGGG + Intergenic
905060020 1:35132168-35132190 GTGGTAAAGGGTGATATTGTGGG + Intergenic
905500169 1:38430165-38430187 GTGGTAAGGGGTGATATTGTGGG - Intergenic
905585983 1:39118732-39118754 GTGGTAAGAGGAAATAGGTTTGG + Intronic
906081311 1:43090570-43090592 GTGGTAAGGGGTGATATTGTGGG - Intergenic
906379325 1:45322188-45322210 GTGGTAAGGGGTGATATTGTGGG + Intergenic
906744123 1:48209594-48209616 GTGGTAAGGGGTGATACTGTGGG + Intergenic
907293027 1:53429395-53429417 GTGGTAAGGGGTGATATTGTGGG - Intergenic
907503184 1:54898481-54898503 GTGGTAAGGGGTGATATTGTGGG + Intergenic
907504489 1:54907822-54907844 GTGGTAAGGGGTGATATTGTGGG + Intergenic
907521657 1:55027687-55027709 GTGGTAAGGGGTGATATTGTGGG - Intergenic
908219728 1:61993071-61993093 GTGGTGGGAGACAGTATTGTGGG - Intronic
908378654 1:63573285-63573307 ATGGTAAGGGGTGATATTGTGGG + Intronic
908461311 1:64350577-64350599 GTGGTAAGGGGTGATATTGTGGG + Intergenic
908591723 1:65643821-65643843 GTGGTAAGGGGTGATATTGTGGG + Intergenic
908852798 1:68391359-68391381 GTGGTAAGGGGTGATATTGTGGG - Intergenic
909015253 1:70373388-70373410 GTGGTAAGGGGTGATATTGTGGG - Intronic
909035859 1:70593385-70593407 GTGGTAAGGGGTGATATTGTGGG - Intergenic
909222353 1:72981063-72981085 GTGGTAAGAGGTGATATTGTGGG + Intergenic
909223264 1:72988432-72988454 GTGGTAAGGGGTGATATTGTGGG + Intergenic
909550640 1:76895403-76895425 GTGGTAAGGGGTGATATTGTGGG + Intronic
909575570 1:77172584-77172606 GTAGTAAGTGGTAATATTGCAGG + Intronic
909776285 1:79489197-79489219 GTGGCAAGGGGTGATATTGTGGG + Intergenic
909787876 1:79639347-79639369 GTGGTAAGGGGTGATATTGTGGG + Intergenic
909792584 1:79696953-79696975 GTGGTAAGGGGTGATATTGTGGG + Intergenic
909961283 1:81846765-81846787 TTGGTTAGAGACAATATAGTAGG + Intronic
909978049 1:82068136-82068158 GTGGAAAGGGGTGATATTGTGGG + Intergenic
910002289 1:82355148-82355170 GTGGTAAGGAGTGATATTGTGGG + Intergenic
910049852 1:82960981-82961003 GTGGTAAGGGGTGATACTGTGGG - Intergenic
910254806 1:85237308-85237330 GTGGTAGGAGGTGATATTATGGG + Intergenic
911510196 1:98801680-98801702 GTGGTAAGGGGTGATATTGTGGG + Intergenic
911570777 1:99514718-99514740 GTGGTAAGGGGTGATATTGTGGG - Intergenic
911626566 1:100131448-100131470 GTGTTAAATGGCAATATTTTTGG - Intronic
911747168 1:101452743-101452765 GTACTAAGAGGCAAAATGGTGGG + Intergenic
911759264 1:101597809-101597831 GTGGTAAGGGGTGATATTGTGGG + Intergenic
911983634 1:104596729-104596751 GTTGTAAGAGGTGATATGGTGGG - Intergenic
911984380 1:104602185-104602207 GTGGCAAGGGGTGATATTGTGGG - Intergenic
912296847 1:108478029-108478051 GTGGTAAGGGGTGATATTGTGGG - Intergenic
912814024 1:112814787-112814809 GTGGTAAGGGGTGATATTGTGGG - Intergenic
912814841 1:112820715-112820737 GTGGTAAGGGGTGATATTGTGGG + Intergenic
913095174 1:115509725-115509747 GTGGTAAGGGGTGATATTATGGG + Intergenic
913655572 1:120956523-120956545 GTGGTAAGGGGTGATATTGTGGG + Intergenic
915816940 1:158977495-158977517 GTGAGAAGAGGGAATATGGTGGG - Intergenic
916036505 1:160927184-160927206 GTAGTAAATGGCAATATTGCAGG - Intergenic
916106025 1:161433097-161433119 TTGGTCAGAGGCAATGCTGTTGG + Intergenic
916329245 1:163595927-163595949 GTGGTAAGGGGCGATATTGTGGG - Intergenic
916800422 1:168210650-168210672 TTTGTTAGAGGCTATATTGTAGG - Intergenic
916942223 1:169688111-169688133 GTGGTAAGGGGTGATATTATGGG - Intronic
917098749 1:171425450-171425472 GTGTTAAGAGACAAAATTGCAGG + Intergenic
917256760 1:173124226-173124248 GTGGTAAGGGGCGATATTGTGGG - Intergenic
917483629 1:175434653-175434675 GTGGTAAGAGGTAAGGTTGGGGG - Intronic
917750108 1:178045262-178045284 GTGGTCAGGGGTGATATTGTGGG - Intergenic
918347509 1:183618737-183618759 GTGGTAAGGGGTGATATTGTGGG - Intergenic
918567272 1:185948912-185948934 GTGGTAAGGGGTGATATTGTGGG + Intronic
918645711 1:186902377-186902399 GTGATAAGGGGTGATATTGTGGG - Intronic
918714011 1:187766142-187766164 GTGGTAAGGGGTGATATTGTGGG + Intergenic
919476857 1:198040380-198040402 GTGGTAAGGGGTGATATTGTAGG - Intergenic
920089146 1:203440127-203440149 GTGGGAAGAGGCAGTAATGAAGG + Intergenic
920136337 1:203772145-203772167 GTGGTAAGAGTCAAGCTTCTTGG + Exonic
920829709 1:209453347-209453369 GTGGTAAGGGGTGATATTGTGGG - Intergenic
920901143 1:210111626-210111648 GTGGTAAGGGGTAATACTGTAGG + Intronic
921212725 1:212913995-212914017 GTGGTAAGGGGTGATATTGTGGG - Intergenic
921459399 1:215410746-215410768 GTGGTAAGGGGTGATATTGTGGG + Intergenic
921509667 1:216013255-216013277 GTGGTAAGGGGTGATATTGTGGG - Intronic
921520744 1:216152007-216152029 GTGGTAAGGTGTGATATTGTGGG - Intronic
921732585 1:218594419-218594441 GTGGTAAGGGGTGATATTGTGGG + Intergenic
922048791 1:221970988-221971010 GTGGTAAGGGTTGATATTGTGGG - Intergenic
922049143 1:221973711-221973733 GTGGTAAGGGGTGATATTGTGGG + Intergenic
922153673 1:223025025-223025047 GTGGTAAGGGGTGATATTGTGGG + Intergenic
922363069 1:224840508-224840530 GTGGTAAGGGGTGATATTGTGGG + Intergenic
922844932 1:228677170-228677192 GGGGTAAGGGGTGATATTGTGGG + Intergenic
922877465 1:228951296-228951318 GTGGTAAGGGGTGATATTGTGGG - Intergenic
922906792 1:229179522-229179544 GTGGTAAGGGGTGATATTGTGGG - Intergenic
922935285 1:229418016-229418038 GTGGTAAGGGGTGACATTGTGGG - Intergenic
923075895 1:230608456-230608478 GTGGTAAGGGGTGATATTGTGGG - Intergenic
923245160 1:232123290-232123312 GTGGTAAGGGGTGATATTGTGGG - Intergenic
923256941 1:232230243-232230265 GTGGTAAGGGGTGATATTGTGGG + Intergenic
923408237 1:233684063-233684085 GTGGTAAGGGGTGATATTGTGGG + Intergenic
923614311 1:235524281-235524303 GTTGCAAGAGGCAGTTTTGTTGG + Intergenic
923770358 1:236932928-236932950 GTGGTAAGGGGTGATATTGTGGG + Intergenic
923963186 1:239106459-239106481 GTGGTAAGGGGTGATATTGTGGG - Intergenic
924181088 1:241439278-241439300 GTGGAAAGGGGTGATATTGTGGG - Intergenic
924895722 1:248336299-248336321 GTGGTAAGGGGTGGTATTGTGGG + Intergenic
1063363592 10:5476410-5476432 GTGGTAAGGGGTGATATTGTAGG - Intergenic
1063509202 10:6630212-6630234 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1063527294 10:6797716-6797738 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1065442728 10:25769377-25769399 GTGGTAAGGGATGATATTGTGGG + Intergenic
1065610948 10:27470283-27470305 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1066102992 10:32134269-32134291 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1066436665 10:35402195-35402217 GGGGTAAGGGGTGATATTGTGGG + Intronic
1067360701 10:45575508-45575530 GTGGTAAGAGGTGATATTGTGGG - Intronic
1068057958 10:52034390-52034412 GTGGTAAGGGGTGATATTGTGGG + Intronic
1068089181 10:52411473-52411495 CTGGTAAGATCAAATATTGTTGG - Intergenic
1068178589 10:53493355-53493377 GTGGTAAGGGGTGATATTGTCGG + Intergenic
1068231371 10:54171852-54171874 GTGGTAAGGGGTGATATTGTGGG - Intronic
1068522686 10:58094656-58094678 GCGGTAAGGGGTGATATTGTGGG + Intergenic
1068591944 10:58861627-58861649 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1070475235 10:76823090-76823112 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1070893910 10:79965360-79965382 GTGGTAAGGGGTGATATTGTGGG - Intronic
1071187721 10:83062783-83062805 GGGGTAAGGGGTGATATTGTGGG - Intergenic
1071590111 10:86864846-86864868 GTGGTAAGGGGTGATATTGTGGG - Intronic
1071822226 10:89290327-89290349 GTGGTAAGGGGTGATACTGTGGG - Intronic
1071897350 10:90081652-90081674 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1071916601 10:90300086-90300108 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1071954104 10:90738478-90738500 GTGGTATTAGGTAATATTTTTGG - Intergenic
1071961526 10:90812604-90812626 GTGGTAAGGGGTGATATTGTGGG - Intronic
1072010875 10:91301874-91301896 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1072559334 10:96556278-96556300 CAGGTAAGAGGCAGTATTGTTGG - Intronic
1072580492 10:96735980-96736002 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1072689587 10:97563030-97563052 GGGGTAAAGGGTAATATTGTGGG + Intronic
1073395373 10:103213028-103213050 ATGGTAAGAGGTGATATTGTGGG - Intergenic
1073436629 10:103520823-103520845 GTGGTAAGGGGTGATATTGTGGG + Intronic
1073684021 10:105733214-105733236 GTGGTAAGGGGTGATACTGTGGG - Intergenic
1074019471 10:109567634-109567656 GTGGTAACGGGTGATATTGTGGG - Intergenic
1074572463 10:114636447-114636469 GAGGCAGGAGGCAATATGGTTGG - Intronic
1074741198 10:116485906-116485928 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1075249094 10:120849926-120849948 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1077588214 11:3470836-3470858 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1077612588 11:3653030-3653052 GTGGTAAGGGGTGATATTGTGGG - Intronic
1077678662 11:4219919-4219941 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1077688069 11:4316322-4316344 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1077765990 11:5160889-5160911 GTGGTAAGGGGTGATATTGTGGG + Intronic
1077850414 11:6070455-6070477 GTGGTAAGGGGTGATATTGCGGG + Intergenic
1077872363 11:6272719-6272741 GTGTAAAGAGGTGATATTGTTGG - Intergenic
1077883790 11:6371046-6371068 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1078045751 11:7912779-7912801 GTGGTAAGGGGTGATATTGCGGG + Intergenic
1078789520 11:14528426-14528448 GGGGTAAGGGGTGATATTGTGGG - Intronic
1079447749 11:20572010-20572032 GTGGTAAGAGGTGATATTGTGGG - Intergenic
1079672177 11:23184568-23184590 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1079695607 11:23478409-23478431 TTGGTAAGAACAAATATTGTTGG - Intergenic
1079726690 11:23887814-23887836 GTGGTAAGAGGTGATATTGTGGG + Intergenic
1079847174 11:25487087-25487109 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1080027515 11:27629702-27629724 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1080203824 11:29706290-29706312 GTGGTAAGGGGTGATATCGTGGG + Intergenic
1081160235 11:39740430-39740452 GTAGTAAGGGGTGATATTGTGGG - Intergenic
1081357084 11:42124676-42124698 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1082197233 11:49321131-49321153 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1083534925 11:63458853-63458875 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1084232691 11:67764751-67764773 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1084243911 11:67842479-67842501 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1084354950 11:68632151-68632173 ATGGTAAGGGGTGATATTGTGGG - Intergenic
1084355945 11:68638788-68638810 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1084585339 11:70058049-70058071 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1084612883 11:70214851-70214873 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1084828776 11:71752097-71752119 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1085421093 11:76361005-76361027 CTGGTAAGATCAAATATTGTTGG + Exonic
1085570608 11:77555068-77555090 GGGGTAAGGGGTGATATTGTGGG - Intronic
1085934679 11:81126874-81126896 GTGGTAAGGGGTGATATTGCGGG - Intergenic
1085988501 11:81812065-81812087 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1086005442 11:82030350-82030372 GTGGTAAGGGGTGACATTGTGGG - Intergenic
1086125169 11:83342573-83342595 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1086134297 11:83431227-83431249 TTGGTAAGGGGTGATATTGTGGG + Intergenic
1086135772 11:83442719-83442741 GTGGTAAGGGGTGATATTGCGGG + Intergenic
1086550720 11:88049025-88049047 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1086658588 11:89386989-89387011 GTGGTAAGGGGTGATATTGTGGG - Intronic
1087099483 11:94350811-94350833 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1087100058 11:94354935-94354957 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1087128210 11:94646699-94646721 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1087167505 11:95019992-95020014 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1087197657 11:95317127-95317149 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1087315070 11:96593019-96593041 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1087839112 11:102904500-102904522 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1088555379 11:111055494-111055516 GTGGTAAGGGGTGATATCGTGGG - Intergenic
1089349383 11:117813692-117813714 GTGGTAAGGGGTGATATTGTGGG - Intronic
1089470665 11:118717624-118717646 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1089866576 11:121637986-121638008 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1089954105 11:122554947-122554969 GTGGTAAAGGGTGATATTGTGGG - Intergenic
1089988068 11:122832209-122832231 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1090107146 11:123865895-123865917 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1090546064 11:127769501-127769523 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1090850199 11:130565009-130565031 GTGGTAAGGGGTGAGATTGTGGG + Intergenic
1090871568 11:130754131-130754153 GTGGTAAGGGGTGAGATTGTGGG + Intergenic
1090926531 11:131255111-131255133 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1091184105 11:133632093-133632115 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1091886828 12:4023041-4023063 GTGGTAAGGGGTGAGATTGTGGG - Intergenic
1092414470 12:8279603-8279625 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1092474872 12:8809970-8809992 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1092580330 12:9834530-9834552 GTGGTAAGGGGTGATATTGTGGG + Intronic
1092626365 12:10333610-10333632 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1092723342 12:11462799-11462821 ATGGTAAGGGGTGATATTGTGGG + Intronic
1092738936 12:11610372-11610394 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1092790099 12:12063479-12063501 GTGGTAAGGGGTGATATTGTGGG - Intronic
1092924389 12:13260211-13260233 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1093070855 12:14706086-14706108 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1093267656 12:17022505-17022527 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1093321585 12:17720832-17720854 GTGGTAAGGGGTGATACTGTAGG + Intergenic
1093359233 12:18203024-18203046 GTGGTAAGGGGTGATATTGTGGG - Intronic
1093579197 12:20768404-20768426 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1093812400 12:23506473-23506495 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1093951578 12:25168903-25168925 ATGGTAAGGGGTGATATTGTGGG - Intronic
1094315582 12:29135243-29135265 ATGGTAAGGGGCGATATTATGGG + Intergenic
1094401181 12:30061852-30061874 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1094723418 12:33088463-33088485 GCGGTAAGGGGTGATATTGTGGG + Intergenic
1094826525 12:34273556-34273578 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1095778760 12:46036399-46036421 GTAGTAAGGGGTGATATTGTGGG - Intergenic
1095805996 12:46321861-46321883 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1096035886 12:48469837-48469859 GTGGGAAGAGACAGTGTTGTGGG - Intergenic
1096906729 12:54943110-54943132 GTGTTAAGGGGTGATATTGTGGG + Intergenic
1097416663 12:59323847-59323869 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1097541691 12:60951853-60951875 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1097592829 12:61592353-61592375 GTGGTAAGAGGCGATATTGTGGG - Intergenic
1098173273 12:67767432-67767454 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1098293780 12:68983664-68983686 GTAGTAAATGGCAATATTGCAGG + Intergenic
1098402540 12:70089620-70089642 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1098406480 12:70131869-70131891 GTGGTAAGGGGTGATTTTGTGGG + Intergenic
1098499335 12:71172002-71172024 TTTGTAAGAGGCAATACTATGGG - Intronic
1098622997 12:72627609-72627631 GTGGACAGTTGCAATATTGTAGG + Intronic
1098629435 12:72708317-72708339 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1098629589 12:72709303-72709325 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1098639106 12:72818279-72818301 GTGGTAAGGGGTAATATTATGGG + Intergenic
1098639941 12:72826183-72826205 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1098653400 12:73002435-73002457 GTGGTAAGGAGTGATATTGTGGG + Intergenic
1098920389 12:76297168-76297190 GTGGTAAGGGGCGATATTGTGGG - Intergenic
1099131726 12:78841235-78841257 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1099189114 12:79544970-79544992 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1099291697 12:80783699-80783721 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1099301510 12:80900403-80900425 GTGTTAAGAGGGAATTTTATAGG - Intronic
1099382787 12:81975791-81975813 GTGGTAAGGGGCGATAATATGGG + Intergenic
1099763022 12:86944110-86944132 ATGGTAAGGGGTGATATTGTGGG - Intergenic
1099835678 12:87907868-87907890 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1100388383 12:94124692-94124714 GTGGAAAGAGGGAATAATATAGG + Intergenic
1100561749 12:95754254-95754276 GTGGTAAGGGGTGATATTGTGGG - Intronic
1100940806 12:99721126-99721148 GTGGTAAGGGGTGATATTGTGGG - Intronic
1101278003 12:103223306-103223328 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1102116297 12:110405644-110405666 GTGGTAAGGGACAATATTGTGGG + Intergenic
1102324485 12:111968226-111968248 GTGAGAACAGGCACTATTGTTGG - Intronic
1102605150 12:114062762-114062784 GGGGTAAGGGGTGATATTGTAGG - Intergenic
1105032992 12:132897838-132897860 GTGGTAAGGGGTGATATTGTGGG - Intronic
1106943718 13:34802730-34802752 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1107075971 13:36321536-36321558 GTGGTAAGGGGTGATATTGTGGG - Intronic
1107219862 13:37969590-37969612 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1107682832 13:42868638-42868660 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1107702282 13:43060278-43060300 GGGGTAAGGGGTAATATTGTGGG + Intronic
1108203136 13:48061680-48061702 GTGGTAAGGGGTGATATTATGGG - Intronic
1108281579 13:48867272-48867294 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1108513301 13:51174350-51174372 GTGGTAAGGCGTGATATTGTGGG - Intergenic
1108803446 13:54127997-54128019 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1108913027 13:55578859-55578881 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1108919154 13:55655565-55655587 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1108947861 13:56045620-56045642 GTGGTAAGGCGTGATATTGTGGG - Intergenic
1108952552 13:56113032-56113054 GTGGTAAGGCGTGATATTGTGGG + Intergenic
1109344019 13:61093824-61093846 GTGGTAAGGGGTGATATCGTGGG - Intergenic
1109353395 13:61210673-61210695 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1109499741 13:63218514-63218536 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1109709276 13:66141946-66141968 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1109716341 13:66226997-66227019 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1110254607 13:73418736-73418758 AAGGTAAGAGGAAATATTGGAGG + Intergenic
1110380931 13:74849802-74849824 GTTTTAAGAGGCAAAATGGTAGG - Intergenic
1110650070 13:77933814-77933836 GTGGTAAGGAGTGATATTGTGGG + Intergenic
1110765877 13:79279207-79279229 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1110845806 13:80189326-80189348 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1110978942 13:81871830-81871852 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1111125643 13:83908912-83908934 GTGGTAAGGGGCGATATTGTGGG + Intergenic
1111361707 13:87187038-87187060 GTGGTAAGGGGCGATATTGTGGG + Intergenic
1111458451 13:88513452-88513474 GTGGTAAGAGGTGATATTGCAGG + Intergenic
1111630825 13:90844504-90844526 GTGGTAAGGGGCGATATTGTGGG - Intergenic
1111631312 13:90849206-90849228 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114234914 14:20815130-20815152 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1114334670 14:21676035-21676057 GTAGTAAGAGGTAATATTGCAGG + Intergenic
1114582935 14:23780708-23780730 GTGGGAAGAGGCACTATTCCTGG - Intergenic
1115240336 14:31247012-31247034 GTGGTAAGGGATGATATTGTGGG + Intergenic
1115569640 14:34654566-34654588 GGGGTAAGGGGTGATATTGTGGG - Intergenic
1115905209 14:38195873-38195895 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1116180091 14:41521226-41521248 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1116534388 14:46013039-46013061 GTGGTAAGAGGTGATATTGTGGG + Intergenic
1116573846 14:46549004-46549026 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1117174785 14:53134919-53134941 GGGGTAAGGGGTGATATTGTGGG - Intronic
1117801566 14:59449175-59449197 GTGGTAAAGGGTGATATTGTGGG - Intronic
1117957486 14:61133825-61133847 GTGGTAAGGGGTGATACTGTGGG + Intergenic
1118936551 14:70294065-70294087 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1119022803 14:71129395-71129417 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1119152122 14:72370773-72370795 GTGCTAAGAAGAAATACTGTGGG - Intronic
1119247947 14:73129003-73129025 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1119317594 14:73708583-73708605 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1119825877 14:77656732-77656754 GTGATAAGAGGCCAAATTGCAGG + Intergenic
1120250960 14:82061494-82061516 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1120539082 14:85733022-85733044 GTGGTAAGAGGTGATATTGTGGG + Intergenic
1120618633 14:86736448-86736470 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1120973863 14:90231983-90232005 TTGGTCAGAGGCAATGCTGTTGG - Intergenic
1121389226 14:93560023-93560045 GTGGTAAGGGGTGATATTGTGGG + Intronic
1121980142 14:98447388-98447410 GTGGTAAGGGATGATATTGTGGG + Intergenic
1122041676 14:98992260-98992282 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1122380849 14:101305835-101305857 GTGGTAAGGGGTGATATTGCAGG + Intergenic
1122528918 14:102411084-102411106 GTGGTAAGGGGTGATATCGTGGG - Intronic
1123882071 15:24685932-24685954 GCGGTAAGGGGTGATATTGTGGG + Intergenic
1123926884 15:25123010-25123032 TTGGAAAGAGGCAATAGGGTAGG - Intergenic
1124040283 15:26095668-26095690 GTGGTAAATGGCAATATTGCAGG - Intergenic
1125046076 15:35243199-35243221 GTGGTAAGGGGTGATATTGTGGG - Intronic
1125131127 15:36286254-36286276 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1125212818 15:37236808-37236830 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1125703193 15:41706941-41706963 AGGTTAAGAGGCAATATTTTGGG - Intronic
1126529679 15:49699110-49699132 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1126912023 15:53427460-53427482 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1129259855 15:74359185-74359207 GTGGTAAGGGGTGATATTGTGGG - Intronic
1129953959 15:79616139-79616161 CTGGTTAGTGGCAATAGTGTTGG + Intergenic
1130217206 15:81983615-81983637 GTGGTAAGAGGCAATGCGGATGG + Intergenic
1130305032 15:82707816-82707838 GTGGTAAGGGATGATATTGTGGG - Intronic
1130679638 15:85985230-85985252 GTGGGAAGAGACACTATTGGAGG - Intergenic
1130781510 15:87044909-87044931 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1130855502 15:87836368-87836390 GTGATAAGGGGTGATATTGTGGG - Intergenic
1130888588 15:88114065-88114087 GTGGCATGAGGCAACATTATGGG + Intronic
1130945522 15:88547897-88547919 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1131102053 15:89700235-89700257 GTGGAAACAGGCATTATTCTTGG + Intronic
1131448166 15:92516814-92516836 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1131685152 15:94759761-94759783 GTGGTAAGGGGTGATGTTGTGGG - Intergenic
1131882125 15:96872492-96872514 GTGGTAAGGGGTGATACTGTGGG + Intergenic
1133313663 16:4868275-4868297 GTGTTAATAGGTAATATGGTGGG + Intronic
1133765321 16:8833646-8833668 GTGGTAAGGGGTGATATTGTGGG + Intronic
1133766063 16:8838578-8838600 GTGGTAAGGGGTGATATTGTGGG + Intronic
1133869088 16:9671161-9671183 GTGGTAAGGGGTGATATTGTGGG + Intronic
1133939233 16:10294632-10294654 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1134246211 16:12542081-12542103 TTGGGAAGAGACAATATTGCAGG - Intronic
1134341790 16:13353194-13353216 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1136407100 16:30054424-30054446 GTGGAAAGGGGCAAAATTGCAGG + Intronic
1136530378 16:30864464-30864486 GGGGTAAGGGGTGATATTGTGGG - Intronic
1137363941 16:47844373-47844395 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1138061792 16:53899004-53899026 GTAATAAGAGGTAATATTTTAGG - Intronic
1138758331 16:59515597-59515619 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1138805343 16:60083924-60083946 GTGGTAAGGGGCGATGTTGTGGG - Intergenic
1138846965 16:60578513-60578535 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1139225523 16:65230439-65230461 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1139230192 16:65275871-65275893 GTGGTAAGGGGTGATACTGTGGG + Intergenic
1139942656 16:70617094-70617116 GTGGTAAGGGGTGATATTGTGGG + Intronic
1141000456 16:80302712-80302734 GAGGTGAGAGGCAGAATTGTGGG - Intergenic
1141093527 16:81146950-81146972 GTGGTCAGAGGCCCTAGTGTAGG + Intergenic
1141796818 16:86280636-86280658 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1141864804 16:86742644-86742666 GTGGTAAGGGGTGATACTGTGGG + Intergenic
1144104971 17:11976310-11976332 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1145080275 17:19889064-19889086 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1146598292 17:34188370-34188392 GTGGTAAGGGGTGATATTTTGGG - Intergenic
1147805205 17:43126301-43126323 GTGGTAAGAGCCAATCTTCTTGG + Intergenic
1148525862 17:48333611-48333633 GTGTTAAGAGGCAATATATATGG - Intronic
1149126110 17:53235531-53235553 ATGTTAAGAAACAATATTGTTGG + Intergenic
1149221122 17:54416193-54416215 GGGGTAAGAGGTGATATTGTGGG - Intergenic
1149320416 17:55475875-55475897 GGGGTAAGGGGTGATATTGTGGG - Intergenic
1150930556 17:69580113-69580135 GAGGTAAGAGGAAATATTTGGGG + Intergenic
1151503177 17:74505830-74505852 GGGGTAAGGGGTGATATTGTGGG - Intergenic
1151839359 17:76606580-76606602 GTGGTAAGGGGTGATACTGTGGG + Intergenic
1151877822 17:76877355-76877377 GTGGTAGGAGGCTATCTTTTGGG + Intronic
1152061571 17:78079798-78079820 CTGGTCAGAAGCAATATTGAGGG + Intronic
1152648988 17:81483301-81483323 GAGGAAAGAGGAAACATTGTGGG + Intergenic
1153192486 18:2557353-2557375 GTGGAAACAGGCACTATTCTTGG - Intronic
1153881134 18:9422595-9422617 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1155174298 18:23289448-23289470 GTGGTAAGGGGTGATATTGTGGG - Intronic
1155892279 18:31284781-31284803 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1155962404 18:32005731-32005753 GTAGTAAGTGGTGATATTGTGGG - Intergenic
1156237908 18:35221904-35221926 GTGGTAAGGGATGATATTGTGGG - Intergenic
1156916540 18:42469121-42469143 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1156938920 18:42741741-42741763 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1156958621 18:42996195-42996217 ATGGTAAGGGGTGATATTGTGGG - Intronic
1157093988 18:44669939-44669961 GTGATTAGAGACAATATTATGGG + Intergenic
1157546914 18:48553127-48553149 GTGCAAAGAGGTAATTTTGTAGG - Intronic
1157905995 18:51570654-51570676 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1158117564 18:54013288-54013310 GGGGTAAGGGGTGATATTGTGGG - Intergenic
1158336757 18:56420689-56420711 GCGGTAAGGGGTGATATTGTGGG - Intergenic
1158393977 18:57065283-57065305 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1158576336 18:58641756-58641778 GTGGTAAGGGGCGATATTATGGG + Intergenic
1159164884 18:64686718-64686740 GTGGTAAGGGGTGATACTGTGGG - Intergenic
1159835440 18:73329727-73329749 GTGGTAAGGGGTGGTATTGTGGG - Intergenic
1159929762 18:74298484-74298506 GTGGTAAGGGGTGATATTCTGGG - Intergenic
1161662004 19:5552567-5552589 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1161711257 19:5849574-5849596 GGGGTAAGGGGTGATATTGTGGG - Intronic
1162287604 19:9751214-9751236 GGGGTAAGGGGTGATATTGTGGG - Intergenic
1163899392 19:20088317-20088339 GTGGTAAGGGGTGATATTGTGGG + Intronic
1163907569 19:20160630-20160652 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1164081289 19:21863629-21863651 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1164153520 19:22574339-22574361 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1164202036 19:23026985-23027007 GTGGTAAGGGGTGACATTGTGGG + Intergenic
1164459006 19:28431803-28431825 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1165496618 19:36156082-36156104 GTGGAAAGGGGTGATATTGTGGG + Intergenic
1165509936 19:36260109-36260131 GTGGAAAGGGGTGATATTGTGGG + Intergenic
1165835751 19:38754688-38754710 GTGGTAAAGGGTGATATTGTGGG - Intronic
1166038792 19:40190100-40190122 CTTGTAAGAGGCAAAATTCTGGG - Intergenic
1166498543 19:43324126-43324148 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1166905147 19:46102932-46102954 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1166926686 19:46273785-46273807 GTGGTAACAGTTGATATTGTGGG + Intergenic
1167046217 19:47050460-47050482 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1167099861 19:47398111-47398133 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1167741959 19:51329201-51329223 GAGGTGAGAGGCAATAGGGTTGG - Exonic
1167902538 19:52632842-52632864 GTGGTAAGGGGTGATATTGTGGG - Intronic
1167917791 19:52756262-52756284 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1168052033 19:53836693-53836715 GTGGTGAGGGGTGATATTGTGGG - Intergenic
1168211641 19:54894891-54894913 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1168227593 19:55007419-55007441 GTGGTAAGGGGTGACATTGTGGG + Intergenic
925433394 2:3816114-3816136 GTGGTAAGGGGCGATATTGTGGG + Intronic
925544943 2:5006076-5006098 GTGGTAAGGGGTGATATTGTGGG - Intergenic
925828438 2:7873334-7873356 GTGGTAAGGGGTGATATTGTGGG + Intergenic
926413981 2:12631595-12631617 GTGGTAAGGGGTGATATTGTGGG - Intergenic
926463661 2:13164400-13164422 GTGGTAAGGGTTGATATTGTGGG + Intergenic
926815157 2:16792558-16792580 GTGGTAAGGGGTGATATTGTGGG + Intergenic
927059107 2:19397492-19397514 GTGGGAAGAGGCTACAGTGTGGG - Intergenic
927134589 2:20087498-20087520 GTGGTAAGGGGTGATATTGTGGG - Intergenic
927253151 2:21016682-21016704 GTGGTAAGAAGCTATGTTTTGGG + Intronic
928382111 2:30827188-30827210 GTAGTAAATGGTAATATTGTAGG + Intergenic
928770341 2:34697055-34697077 GTGGTAAGGGGGGATATTGTGGG + Intergenic
928778790 2:34795445-34795467 GTGGTAAGGGGTGATATTGCGGG - Intergenic
928779314 2:34801589-34801611 GTGGTAAGGGGTGATATTGTGGG + Intergenic
928827236 2:35437507-35437529 GTGGTAAGGGGTGATATTGTGGG + Intergenic
928857577 2:35818170-35818192 GTGGTAAGGGGTGATATTGTGGG - Intergenic
928928961 2:36604128-36604150 GTGGTAAGGGGTGGTATTGTGGG - Intronic
929004430 2:37381602-37381624 GTGGTAAGGGGTGGTATTGTGGG + Intergenic
929021023 2:37553167-37553189 ATGGTAAGAGCCACTATGGTAGG + Intergenic
929076280 2:38081382-38081404 GTGGTAAGGGGTGATATTGTGGG + Intronic
929792671 2:45035071-45035093 GTGGTAAGGGGTGATATTGTGGG + Intergenic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
930453088 2:51569122-51569144 GTGGTAACAGGAACTACTGTTGG + Intergenic
930955488 2:57198047-57198069 GTGGTAAGAGGTGATATTGTGGG - Intergenic
930958874 2:57234643-57234665 GTGGTAAGGGGTGATATTGTGGG - Intergenic
931025999 2:58114041-58114063 GTGGTAAGGGGTGATATTGTGGG + Intronic
931043008 2:58318793-58318815 GTGGTAAGGGGTGATATTGTGGG - Intergenic
931237224 2:60421820-60421842 GTGGTAAGGGGTGATATTGTGGG - Intergenic
931626080 2:64256993-64257015 GTGGTAAGGGGTGATATTGTGGG - Intergenic
931850790 2:66248892-66248914 GTGGTAAGGGGTGATATTGTGGG - Intergenic
931948668 2:67336951-67336973 GTGGTAAGGGGTGATATTGTGGG - Intergenic
932158971 2:69443589-69443611 GTGGTAAGGGGTGATATTGTGGG + Intergenic
932296252 2:70625805-70625827 ATGGTAAGGGGTGATATTGTGGG - Intronic
932358590 2:71086991-71087013 GTGGTAAGGGGTGATATTGTGGG + Intergenic
932366831 2:71158389-71158411 GTGGTAAGGGGTGATATTGTGGG + Intergenic
932804336 2:74769962-74769984 GTGGTAAGGGACAGTCTTGTTGG - Intergenic
932853809 2:75214360-75214382 GTGGTAAGGGGTGATATTGTGGG + Intergenic
933062219 2:77752443-77752465 GTGGGGAGAGGCACTATTCTTGG + Intergenic
933079673 2:77970216-77970238 GTGGTAAGGGATGATATTGTGGG - Intergenic
933164108 2:79056470-79056492 GTGGTAAGGGGTGATATTGTGGG - Intergenic
933179326 2:79211939-79211961 GTGGTAAGGGGTGATATTGTGGG + Intronic
933314462 2:80699552-80699574 TTGGTCAGAAGCAATGTTGTGGG - Intergenic
933329289 2:80876412-80876434 GTGGTAAGGGGTGATATTGTGGG + Intergenic
933552013 2:83789539-83789561 GTGGTAAGGGGTGATATTGTGGG + Intergenic
936793844 2:116184346-116184368 GTGGTAAGGGGTGATATTGTGGG + Intergenic
936871045 2:117134505-117134527 GTGGTAAGGGGCAATATTGTGGG - Intergenic
936883716 2:117283829-117283851 GTGGTAAGGGGTGATATTGTGGG - Intergenic
939307876 2:140431788-140431810 GTGGTAAGGGGTGATATTGTGGG - Intronic
939678344 2:145099602-145099624 CTGGGAAAAGGCAATATTGGAGG + Intergenic
939825359 2:147008918-147008940 GTGGTGAGATGAAATATTGAAGG - Intergenic
940107789 2:150117907-150117929 GTGGTAAGGGGTGATATTGTGGG - Intergenic
940183548 2:150959534-150959556 GTGGTAAGGGGTGATTTTGTGGG - Intergenic
940426302 2:153535135-153535157 GTGGTAAGGGGTGATATTGTGGG + Intergenic
940508284 2:154583229-154583251 GTGGTAAGGGGTGATATTGTGGG + Intergenic
940530802 2:154873908-154873930 GTGGTAAGGGGTGATATTGTGGG - Intergenic
940675425 2:156720677-156720699 GTGGTAAGGGGTGATATTGTGGG + Intergenic
941340788 2:164300933-164300955 GTGGTAAGGGGTGATATTGTGGG - Intergenic
941392715 2:164934634-164934656 GTATTATGAGGCAATATTGAGGG - Intronic
941455383 2:165708210-165708232 GTGGTAAGGGGTGATATTGTGGG + Intergenic
941531499 2:166676446-166676468 GTAGTAAGAAGTAATATTGCAGG - Intergenic
941751099 2:169136185-169136207 GTGGTAAGGGGTGATATTGTGGG - Intronic
941935455 2:170978041-170978063 GTGGTAAGGGGTGATATTGTGGG + Intergenic
943061994 2:183049073-183049095 GTGGTAAAGGGTGATATTGTGGG - Intergenic
943412185 2:187558570-187558592 GTGGTAAGGGGTGATATTGTGGG + Intronic
943421191 2:187671108-187671130 GTGGTAAGGGGTGATATTGTGGG + Intergenic
943450581 2:188038524-188038546 GTGGTAAGGGGTGATATTGTGGG - Intergenic
943460722 2:188169281-188169303 GTGGTAAGGGGTGATATTGTGGG + Intergenic
943835787 2:192512565-192512587 TTGGTAAGGGGTGATATTGTGGG - Intergenic
943865875 2:192924213-192924235 GTGGTAAGGGATGATATTGTGGG - Intergenic
943950880 2:194131295-194131317 GTGGTAAGGGGTGATATTGTGGG + Intergenic
943969482 2:194385444-194385466 GTAGTAAGTGGTAATATTGCAGG - Intergenic
944251908 2:197587155-197587177 GTGGTAAGGGGCAATATTGTGGG - Intronic
944387901 2:199185025-199185047 GTGGTAAGGGGTGATGTTGTGGG - Intergenic
944394534 2:199252028-199252050 GTGGTAAGGGGTGATATTGTGGG - Intergenic
944485682 2:200202433-200202455 GTGGTAAGGGGCGATATTGTGGG + Intergenic
944875718 2:203962533-203962555 GTGGTAAGGGGTGATATTGTGGG + Intergenic
945152711 2:206807472-206807494 GTGGTAAGGGGTGATATTGTGGG + Intergenic
945173890 2:207022669-207022691 GTGGTAAGGGGTGATATTGTGGG - Intergenic
945362086 2:208904869-208904891 GTGGTAAGGGGTGATATTGTGGG - Intergenic
945376562 2:209083723-209083745 GTGGTAAGGGGTGATATTGTGGG - Intergenic
945394689 2:209304287-209304309 GTGGTAAGGGGTGATATTGTGGG - Intergenic
945662108 2:212699014-212699036 GTGGTAAGTGAGAATGTTGTTGG + Intergenic
945704678 2:213214294-213214316 GTAGTAAGCAGCAATATTGCAGG - Intergenic
945858621 2:215095463-215095485 GGGGTAAGAGGTGATATTGTGGG - Intronic
945938718 2:215927469-215927491 GTGGTAAGGGGTGATATTGTGGG - Intergenic
946780476 2:223189303-223189325 GTGGTAAGGGGTGATATTGTGGG + Intronic
946871277 2:224087931-224087953 GTGGTAAGGGGCGATATTGTGGG + Intergenic
946893669 2:224301749-224301771 GTGGTAAGGGGTGATATTGTGGG - Intergenic
947842322 2:233215726-233215748 GGGGTAAGGGGTGATATTGTAGG + Intronic
948391086 2:237612039-237612061 GTGGTAAGGGGTGAGATTGTGGG - Intergenic
1168739819 20:178197-178219 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1168942815 20:1727834-1727856 GTGGTAAGGGGTGATATGGTGGG + Intergenic
1169913981 20:10669904-10669926 GTGATAAGAACCATTATTGTGGG - Intronic
1170068468 20:12340886-12340908 GTGGCAAGGGGTGATATTGTGGG + Intergenic
1170106633 20:12758975-12758997 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1170166140 20:13362034-13362056 GTGGCAAGGGGTGATATTGTGGG - Intergenic
1170820414 20:19752659-19752681 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1170927818 20:20741830-20741852 GGGATTAGAGGCAACATTGTAGG + Intergenic
1172932018 20:38592990-38593012 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1173102291 20:40098376-40098398 GTGGTAAGGGGTGATGTTGTGGG - Intergenic
1173119259 20:40274107-40274129 GTGGTAAGGGGTGATGTTGTGGG - Intergenic
1173431732 20:42993780-42993802 GTGGCATGATGCAATATTTTAGG - Intronic
1173763384 20:45584836-45584858 GCGGTAAGGGGTGATATTGTGGG + Intergenic
1173782099 20:45764630-45764652 GTGGTAAGGGGTGATATTGTGGG - Intronic
1177030737 21:15980243-15980265 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1177062486 21:16392737-16392759 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1177101068 21:16897635-16897657 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1177103110 21:16919292-16919314 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1177120043 21:17127142-17127164 GTGGTAAGGGGTGACATTGTGGG - Intergenic
1177274892 21:18897572-18897594 GTATTAAGAGGAAAAATTGTGGG + Intergenic
1177840316 21:26228459-26228481 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1178001600 21:28166293-28166315 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1178396170 21:32245726-32245748 GGGGTAAGTGGCAGTTTTGTGGG + Intergenic
1178436354 21:32562201-32562223 GTAGTAAATGGCAATATTGCAGG - Intergenic
1179180944 21:39044556-39044578 GTGGTAAAAGACCATGTTGTGGG - Intergenic
1179387953 21:40960043-40960065 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1179649922 21:42801477-42801499 GTGGTAAAGGGTGATATTGTGGG + Intergenic
1180561062 22:16614504-16614526 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1182732672 22:32507866-32507888 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1182966624 22:34527598-34527620 GTTATAAGAGGAAATATTTTAGG + Intergenic
1182999012 22:34839408-34839430 GTGGTAAAGGGTGATATTGTGGG - Intergenic
949161698 3:891287-891309 GTGGTAAGGGGTGATATTGTGGG + Intergenic
949827831 3:8182102-8182124 GTGGTAAGGAGTGATATTGTGGG - Intergenic
950058882 3:10052495-10052517 CAGGTAAGAGGCAATATGTTGGG + Exonic
950300525 3:11873751-11873773 CAGGTAAGAGGCAATATGTTGGG + Intergenic
950582651 3:13872623-13872645 GTGGCAAGAGGCATTCTAGTGGG - Intronic
950926887 3:16749411-16749433 GTGGTAAGGGGTGATATTGTGGG - Intergenic
951315894 3:21189604-21189626 GTGGTAAGGGGTGATATTGTGGG + Intergenic
951762022 3:26158256-26158278 GTGGTAAGGGGTGATATCGTGGG + Intergenic
951895064 3:27602496-27602518 GGGGTAAGGGGTGATATTGTGGG - Intergenic
951924337 3:27890725-27890747 ATGCTAATAGGCAATAGTGTTGG + Intergenic
952117992 3:30206066-30206088 GTGGTAAGAGGCAGTATTTCTGG - Intergenic
952232176 3:31443746-31443768 GTGGGAAGATGCTAAATTGTTGG - Intergenic
952343128 3:32461535-32461557 GTGGTAAGGGGCGATATTGTGGG + Intronic
952564718 3:34641089-34641111 GTGGTAAGGGGTGATATTGTGGG + Intergenic
952663072 3:35874945-35874967 GTGGTAAGGGGTGATATTGTGGG + Intergenic
952894788 3:38071118-38071140 GTGGTAAGTGGTGATATCGTGGG + Intronic
952895666 3:38076921-38076943 GTGGTAAGGGGTGATATTGTGGG + Intronic
953076743 3:39578423-39578445 GTGGTAAGGGGTGATGTTGTGGG + Intergenic
953177582 3:40566068-40566090 GTGGTAAGGGGTGATATCGTGGG - Intronic
953598961 3:44345202-44345224 GTGGTAAGAGGTGATATTGTGGG + Intronic
953635149 3:44657157-44657179 GTGGTACAAAGCAATATTGGGGG - Intronic
953825318 3:46246908-46246930 GTGGTAAGGGGTGATATTGTGGG + Intronic
953840747 3:46388309-46388331 GTGGTAAGGGGTGATATTGTGGG + Intergenic
954471034 3:50695448-50695470 GTAGTAAATGGCAATATTGGAGG - Intronic
954968877 3:54635112-54635134 ATGGTAAGGGGTGATATTGTGGG + Intronic
955253811 3:57308921-57308943 GTGGTAAGGGGTGATATTGTAGG - Intronic
955401506 3:58595066-58595088 GGGGTAAGGGGTGATATTGTGGG - Intronic
955472321 3:59298549-59298571 TTGAAAATAGGCAATATTGTAGG + Intergenic
956233001 3:67038478-67038500 GTGGTAAGGGGTGATATTGTGGG + Intergenic
956546676 3:70410859-70410881 GTGAAAAGAGACAATATTTTTGG - Intergenic
956709660 3:72028290-72028312 GTGGTAAGGGGTGATATTGTGGG - Intergenic
957059491 3:75470488-75470510 GTGGTAATAGGTGATATTGTGGG + Intergenic
957316435 3:78581848-78581870 GTGGTAAGGGGTGATATCGTGGG + Intergenic
957451965 3:80390869-80390891 GTGGTAAGGGGCAATGTTGTGGG - Intergenic
957452662 3:80400066-80400088 CTGTTAAGGGGCCATATTGTAGG - Intergenic
957734318 3:84187414-84187436 GTGGTAAGAGGCAATATTGTGGG + Intergenic
957734455 3:84188368-84188390 GTAGTAAGGAGTAATATTGTGGG + Intergenic
957986205 3:87575191-87575213 GTGGTAAGGGGTGACATTGTGGG - Intergenic
958183260 3:90086160-90086182 GTGGTAAGGGATGATATTGTGGG - Intergenic
958422440 3:93943478-93943500 GTGGTAAGGGGTGATATTGTGGG - Intronic
958676315 3:97273042-97273064 CTGGTAAGGGGTGATATTGTGGG + Intronic
958755926 3:98249190-98249212 GGGGTAAGGGGTGATATTGTGGG - Intergenic
959287965 3:104440543-104440565 GTGGTAAGGGGTGATATTGTGGG + Intergenic
959485371 3:106923349-106923371 GTGGTAAGGGGTGATATTGTGGG + Intergenic
960282476 3:115794115-115794137 GTGGTAAGGGGTGGTATTGTGGG + Intergenic
960309741 3:116105973-116105995 GTGGTAAGGGGTGATATTGTGGG + Intronic
961164365 3:124753179-124753201 GTGGTAAGGGGTGATATTGTGGG + Intergenic
961239003 3:125393809-125393831 GGGGTATGAGGGAATTTTGTGGG - Intergenic
961293910 3:125868891-125868913 GTGGTAAGGGGTGATATTGTGGG - Intergenic
961344323 3:126252793-126252815 GTAGTAAAAGGCAATGCTGTAGG + Intergenic
961711237 3:128829831-128829853 GTGGTAAGGGGTGATATTGTGGG + Intergenic
961712267 3:128836693-128836715 GTGGTAAGGGGTGATATTGTGGG + Intergenic
961730978 3:128964755-128964777 GTGGTAAGGGGTGATATTGTGGG - Intronic
961881441 3:130064362-130064384 GTGGTGAGGGGTGATATTGTGGG - Intergenic
961892018 3:130138221-130138243 GTGGTAAGGGGTGATATTGTGGG + Intergenic
962205975 3:133434330-133434352 GTGGTAAGGGGTGATATTGTGGG - Intronic
962523486 3:136218082-136218104 GGGGTAAGGGGTGATATTGTGGG + Intergenic
962708894 3:138069335-138069357 GTGTTAATAGTCCATATTGTCGG + Intronic
963059185 3:141211115-141211137 GTGGTAAGGGGTGATATTGTGGG - Intergenic
963320559 3:143805270-143805292 GTGGTAAGGGGTGATATTGTGGG - Intronic
963520869 3:146358862-146358884 GTGGTAAAGGGCAATATTGCGGG - Intergenic
963522046 3:146367361-146367383 GTAGTAAGGGGTGATATTGTAGG - Intergenic
963653639 3:148017213-148017235 GTGCTAAGAGGAAATTTTATAGG + Intergenic
963663746 3:148156727-148156749 GTGGTAAGGGGTGATATTGTGGG - Intergenic
963684719 3:148419441-148419463 GTGATAAGGGGTGATATTGTGGG - Intergenic
963887889 3:150601818-150601840 GGGGTAAGGGGTGATATTGTGGG - Intronic
964124989 3:153226743-153226765 GTGGTAAGGGGTGATATTGGGGG + Intergenic
964230175 3:154457042-154457064 GTGATAAGAAGTAATATTCTAGG + Intergenic
964299757 3:155275023-155275045 GTGGTAAGGGGTGATATTGTGGG + Intergenic
964584156 3:158277038-158277060 GGGCTAAGAGGCAAAATTGAAGG + Intronic
964906141 3:161722504-161722526 GTGGTAAGGGGTGATATTGTGGG + Intergenic
964940455 3:162153998-162154020 GTGGTAAAGGGTGATATTGTGGG + Intergenic
964984042 3:162717658-162717680 GTGGTAAGGGGTGATATTGTGGG - Intergenic
964984536 3:162723435-162723457 GTGGTAAGGGGTGATATTGTGGG + Intergenic
965070797 3:163913378-163913400 GTGGTAAGGGGTGATATTGTGGG - Intergenic
965104852 3:164342769-164342791 GTGGTAAGGGGTGATATTGTGGG + Intergenic
965262215 3:166501185-166501207 GTGGTAAGGGGTGACATTGTGGG + Intergenic
965286139 3:166823191-166823213 GTGGTAAGTGGTGATATTGTGGG + Intergenic
965336764 3:167436525-167436547 GTGGTAAGGGGTGACATTGTGGG - Intergenic
965376107 3:167926309-167926331 GTATTAAGAGGCAAAATGGTGGG + Intergenic
965412289 3:168347062-168347084 GTGGAAAGAGGCAAGAGTGTAGG + Intergenic
965458407 3:168931459-168931481 GTGGTAAGGGGTGATATTGTGGG + Intergenic
965625721 3:170682436-170682458 GTGGTAAGGGGTGATATTGTGGG + Intronic
965639583 3:170818198-170818220 GTGGTAAGAGGTGATGTCGTGGG + Intronic
966067612 3:175835565-175835587 GTGGTAAGGGGTGATATTGTGGG - Intergenic
966085877 3:176066727-176066749 GTGGTAAGGGGTGATATTGTGGG - Intergenic
966232458 3:177666468-177666490 GTGGTAAGGGGTGATATTGTGGG + Intergenic
966279867 3:178214043-178214065 GTGGTAAGGGGTGATATTGTGGG - Intergenic
966397176 3:179515875-179515897 GTGATAAGGGGTGATATTGTGGG + Intergenic
966398049 3:179521877-179521899 GTGGTAAGGGGTGATATTGCGGG - Intergenic
967004846 3:185374418-185374440 GTGGTAAGGGGTGATATTGTGGG + Intronic
967152520 3:186663088-186663110 GTGGTAAGGGGTGATATTGTGGG - Intronic
967211769 3:187176142-187176164 GTGGTAAGGGGTGATATTGTGGG + Intronic
967243790 3:187466893-187466915 GTGGTAAGAGGTGATATTGTGGG + Intergenic
967287095 3:187882691-187882713 GGGGTAAGAAGCAATATTTTGGG + Intergenic
967496620 3:190149593-190149615 GTGGTAAGGGGTGATATTGTGGG - Intergenic
967561780 3:190925206-190925228 GTGGTAAGGGGTGATATTGTGGG - Intergenic
967624225 3:191666892-191666914 GTGGTAAGGGGTGATATTGTGGG + Intergenic
967643427 3:191895959-191895981 GTGGTAAGGGGTGATATTGTGGG + Intergenic
967740861 3:193000780-193000802 GTGGTAAGGGGTGATATTGTGGG - Intergenic
968993758 4:3932465-3932487 GTGGTAAGGGGTGATATTGTAGG - Intergenic
969003401 4:4000671-4000693 GTGGTAAGGGGTGATATTGTTGG + Intergenic
969653626 4:8483021-8483043 GTGGTAAGGGGTGATATTGTGGG + Intronic
969750621 4:9107856-9107878 GTGGTAAGGGGTGATATTGTAGG - Intergenic
969810528 4:9644154-9644176 GTGGTAAGGGGTGATATTGTTGG - Intergenic
970028804 4:11654149-11654171 GTGGTAAGGGGTGATATTGTGGG + Intergenic
970042454 4:11811376-11811398 GTGGTAAGGGGTGATACTGTGGG - Intergenic
970087968 4:12369074-12369096 GTGGTAAGGGGTGATACTGTGGG - Intergenic
970255955 4:14170585-14170607 GTGGTGAGGGGTGATATTGTGGG + Intergenic
970819781 4:20198579-20198601 GGGGTAAGGGGTGATATTGTGGG - Intergenic
970853595 4:20630361-20630383 GTGGTAAGGGGTGATATTGTGGG + Intergenic
971180858 4:24327619-24327641 GTGGTAAGAGGTGATATTGTGGG - Intergenic
971200524 4:24506100-24506122 GTGGTAAGGGGTGATATTGTGGG - Intergenic
972148317 4:36057447-36057469 TTGGGAGGAGGCAATATTGGAGG - Intronic
973058639 4:45691633-45691655 GTGGTAAGGGGTGATATTGTGGG - Intergenic
973710159 4:53621909-53621931 GTTGTAATAGGCAATCCTGTAGG + Intronic
973751522 4:54024908-54024930 GTGGTAAGGGGTGATATTGTGGG - Intronic
973970887 4:56212775-56212797 GTAGTAAATGGCAATATTGCAGG - Intronic
974428010 4:61764877-61764899 GTGGTAAGGGGTGATATTGTGGG + Intronic
974904339 4:68036999-68037021 GTGGTAAGGGGTGATATTGTGGG - Intergenic
975243914 4:72095645-72095667 GTGGGGAGAGGCACTATTATGGG + Intronic
975864703 4:78714476-78714498 GTGGTAAGGGGTGATATTGTGGG + Intergenic
975933495 4:79554599-79554621 GTGGTAAGGGGTGATATTGTGGG + Intergenic
976350804 4:84057595-84057617 GTGGCAAAAGGCAATACTTTGGG - Intergenic
976559013 4:86479860-86479882 GTGGTAAGGGGGGATATTGTGGG - Intronic
976697775 4:87936551-87936573 GTGGTAAGGGGTGATATTGTGGG + Intergenic
976719087 4:88152911-88152933 GTGGTAAGGGGTGATATTGTGGG + Intronic
976739332 4:88342576-88342598 ATGGTAAGGGGTGATATTGTGGG - Intergenic
977010680 4:91629043-91629065 GTGGTAAGGGGTGATATTGTGGG - Intergenic
977012537 4:91655236-91655258 GTGGTAAGGGGTGATATTGTGGG + Intergenic
977042355 4:92030489-92030511 GTGGTAAGGGGTGATATTGTGGG - Intergenic
977062117 4:92272122-92272144 GTGGTAAGGGGTGATATTGTGGG + Intergenic
977074811 4:92439587-92439609 GTGGTAAGGGGTGATATTGTGGG + Intronic
977198040 4:94085245-94085267 GTGGTAAGGGGTGATATTGTGGG + Intergenic
977216767 4:94293868-94293890 GTGGTAAGGGGTGATATTGTGGG + Intergenic
977224871 4:94383518-94383540 GTGGTAAGGGGTGATATTGTGGG + Intergenic
977782031 4:100992273-100992295 GTGGTAAGGGGTGATACTGTGGG + Intergenic
978031912 4:103946389-103946411 GTGGTAAGGGGTGATATTGTGGG - Intergenic
978302845 4:107291200-107291222 GTGGTAAGGGGTGATATTGTGGG + Intergenic
978376823 4:108082644-108082666 GTGGGAGGAGGAAATGTTGTGGG + Intronic
978439005 4:108714246-108714268 GTGGTAAGGGGTGATATTGTGGG - Intergenic
979054230 4:115976287-115976309 GTGGTAAGGGGTGATATTGTGGG + Intergenic
979147001 4:117257183-117257205 GTGGTAAGGGGTGATATTGTGGG - Intergenic
979170567 4:117596737-117596759 GTAGTAAATGGCAATATTGCAGG - Intergenic
979170952 4:117600750-117600772 GTGGTAAGGGGTGATATTGTGGG + Intergenic
979380329 4:119999017-119999039 GTGGTAAGGGGTGATATTGTGGG - Intergenic
979894783 4:126145803-126145825 GTGGTAAGGGGTAATATTGTGGG + Intergenic
980002918 4:127511567-127511589 GTGGTAAGGAGTGATATTGTGGG + Intergenic
980111517 4:128641482-128641504 GTGGTAAGGGGTGATATTGTGGG + Intergenic
980285361 4:130772666-130772688 GTGGTAAGGGGTGATATTGTGGG - Intergenic
980349544 4:131668248-131668270 GTGGTAAGGGGTGAAATTGTGGG - Intergenic
980389318 4:132123276-132123298 GTGGTAAGGGGTGATATTGTGGG - Intergenic
980528313 4:134017770-134017792 GTGGTAAGGGGTGATATTGTGGG - Intergenic
980575254 4:134678527-134678549 GTGGTAAGGGGTGATATTGTGGG + Intergenic
980611414 4:135168049-135168071 GTGGTAAGGGGTGATACTGTGGG + Intergenic
980715192 4:136618255-136618277 GGGGTAAGGGGTCATATTGTGGG - Intergenic
980904331 4:138932938-138932960 GTGGTAAGGGGTGATATTGTGGG - Intergenic
980928083 4:139158559-139158581 GTGGTAAGGGGCGATATTGTGGG + Intronic
981040638 4:140218590-140218612 GTGGTAAGGGGTGATATTGTGGG - Intergenic
981525439 4:145702851-145702873 GTGGTAAGGGGTGATATTGTGGG - Intronic
981864939 4:149406304-149406326 GTGGTAATATTCAATATTATGGG - Intergenic
982083558 4:151813065-151813087 GTGGTAAGGGGTGATATTGTGGG + Intergenic
982180088 4:152741978-152742000 GTGGTGAGGGGTGATATTGTGGG + Intronic
982299280 4:153862552-153862574 GTGCTAAGAGGAAATATCATAGG - Intergenic
982319438 4:154063187-154063209 GCGGTAAGGGGTGATATTGTGGG - Intergenic
982396274 4:154918913-154918935 GTGGTAAGGGGTGATATTGTGGG + Intergenic
982413780 4:155108911-155108933 GTGGTGAGGGGTAATATTATGGG + Intergenic
982496734 4:156104103-156104125 GTGGTAAGGGTTGATATTGTGGG + Intergenic
982535836 4:156605380-156605402 GTGGTAAGGGGTGACATTGTGGG - Intergenic
983024271 4:162714191-162714213 ATGGTAAGGGGTGATATTGTGGG - Intergenic
983055768 4:163097282-163097304 GTGGTAAGGGGTGATATTGTGGG - Intergenic
983056103 4:163100554-163100576 GTGGTAAGGAGTGATATTGTGGG + Intergenic
983345990 4:166525827-166525849 GTGGTAAGGGGTGATATCGTGGG - Intergenic
983359394 4:166709242-166709264 GTGGTAAGGGGTGATATTGTGGG + Intergenic
983359455 4:166709829-166709851 GTGGTAAGGGGTGATATGGTGGG - Intergenic
983360810 4:166721399-166721421 GTGGTAAGGGGTGATATAGTGGG - Intergenic
983414360 4:167436637-167436659 GTGGTAAGGGGTGATATTGTGGG + Intergenic
983448453 4:167881420-167881442 GTGGTAAGGGGTGATATTGTGGG - Intergenic
983659968 4:170121545-170121567 GTGGTAAGGGATGATATTGTGGG - Intergenic
983707959 4:170681730-170681752 GTGGTAAGGGGTGATATTGTGGG - Intergenic
983805399 4:171986647-171986669 GTGGTAAGGGGTGATCTTGTGGG + Intronic
983883265 4:172956245-172956267 GTGGTAAGGGGTGATATTGTGGG + Intronic
984098614 4:175461800-175461822 GTGGTAAGGGGTGATATTGTGGG + Intergenic
984164860 4:176294822-176294844 GTGGTAAGGGGTGATACTGTGGG + Intergenic
984311956 4:178072649-178072671 GAGGAAAAATGCAATATTGTAGG + Intergenic
984322651 4:178212728-178212750 GTGGTAAGGGGTGATATTGTGGG - Intergenic
984393419 4:179167111-179167133 GCGGTAAGGGGTGATATTGTGGG + Intergenic
984412207 4:179408724-179408746 GTGGTAAGAGGCGATATTGTGGG - Intergenic
984437770 4:179726282-179726304 GTGGTAAGGGGTGATATTGTGGG - Intergenic
984700902 4:182818283-182818305 GTGGTAAGGGGTGATATTGTGGG - Intergenic
984838454 4:184044785-184044807 GTGGTAACAGTCCAGATTGTAGG - Intergenic
985056961 4:186044605-186044627 GTGGTAAGGGGTGATATTGTGGG + Intergenic
985078548 4:186242504-186242526 ATGGTAAGGGGTGATATTGTGGG + Intronic
985389490 4:189480167-189480189 GTGGTAAGGGGTGATATTGTGGG + Intergenic
985436149 4:189931253-189931275 GTGGTAAGGGGTGATATTGTGGG - Intergenic
985582739 5:707870-707892 GTGGTAAGGGGAGATATTGTGGG - Intergenic
986193905 5:5520508-5520530 GTGGTAAGGGGAGATATTGTGGG - Intergenic
986333600 5:6736253-6736275 GTGGGAAGTGGCAATACTTTAGG + Intronic
986368182 5:7055623-7055645 GTGGTAAGGGGTGATATTGTGGG + Intergenic
986368204 5:7055788-7055810 GTGGTAAGGGGTGATATTGTGGG + Intergenic
986389270 5:7268679-7268701 GTGGTAAGGGGTGATATTGTGGG - Intergenic
986554620 5:8998950-8998972 GTGGTAAGAAGTGATATTGTGGG + Intergenic
986906034 5:12493844-12493866 GTGGTAAGGGATGATATTGTGGG - Intergenic
987282388 5:16424812-16424834 GTGGAAAGGGGTGATATTGTGGG - Intergenic
987487217 5:18538766-18538788 GTGGTAAGGGGTGATATTGTGGG - Intergenic
987487875 5:18543363-18543385 GTGGTAAGGGGTGATATTGTGGG - Intergenic
987497735 5:18669475-18669497 GTGGTAAGGGGTGATATTGTGGG + Intergenic
987756222 5:22099936-22099958 GTGGTAAGGGGTGATATTGTGGG - Intronic
988199618 5:28051637-28051659 GGGGTAAGGGGTGATATTGTGGG - Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
989403103 5:41030352-41030374 GTTGTAAAAGGGATTATTGTTGG - Intronic
989687953 5:44111034-44111056 GGGGTAAGGGGTGATATTGTGGG + Intergenic
990352614 5:54934027-54934049 GTGGTATCAGGCACTATTCTAGG + Intergenic
990483704 5:56236707-56236729 GTGGAAAGAGGGAATAGAGTTGG - Intergenic
990564655 5:57017089-57017111 GGGGTAAGGGGTGATATTGTGGG + Intergenic
992251803 5:74883334-74883356 GTGGCAAGGGGCGATATTGTGGG + Intergenic
992451538 5:76880514-76880536 GTGGTAAGGGGTGATATTGTGGG + Intronic
992961265 5:81958621-81958643 GTGGTAAGATGTGATATTGTGGG - Intergenic
993193097 5:84703555-84703577 GTGGTAAGGGGTGATATTTTGGG - Intergenic
993837075 5:92829074-92829096 GTGGAAAGGGGTGATATTGTGGG - Intergenic
994125620 5:96166994-96167016 GTGGTAAGGGGCGATATTGTGGG + Intergenic
994295604 5:98084715-98084737 GTGGCAAGGGGTGATATTGTGGG - Intergenic
994342958 5:98653576-98653598 TTGGTCTAAGGCAATATTGTAGG - Intergenic
994375303 5:99011436-99011458 GTGGTAAGGGGTGATATTGCAGG + Intergenic
994532174 5:100984906-100984928 GTGGTAAGGGGTGATATTGTGGG + Intergenic
994557299 5:101319986-101320008 GTGGTAAGGGGTGACATTGTGGG - Intergenic
994776067 5:104036702-104036724 GTGGTAAGGGGTGATATTGTGGG - Intergenic
994851379 5:105058160-105058182 GTGGCAAGAGGCATAAGTGTGGG - Intergenic
994989934 5:106983431-106983453 GTGGTAAGGGGTGATATTGTGGG - Intergenic
995122893 5:108554368-108554390 GTGGTAAGGGGTGATATTGTGGG - Intergenic
995124660 5:108568256-108568278 GTGGTAAGGGGTGATATTGTGGG + Intergenic
995297047 5:110534917-110534939 GTGGTAAGGGGTGATATTGTGGG - Intronic
995581059 5:113603150-113603172 GTGGGAACAGGCACTATTTTTGG - Intergenic
995898986 5:117047035-117047057 GTGGTAAGGGGTGATACTGTGGG + Intergenic
996202871 5:120698222-120698244 GTGGTAAGGGGTGATACTGTGGG + Intergenic
996344518 5:122474824-122474846 GTGGTAAGGGGTGATATTGTGGG + Intergenic
996357967 5:122617532-122617554 GTGGTAAGGGGTGATATTGTGGG + Intergenic
996510289 5:124308860-124308882 GTGGTAAGGGGTGATATTGTGGG - Intergenic
996528432 5:124502129-124502151 GTGGTAAGGGGTGATATTGTGGG - Intergenic
996574590 5:124967272-124967294 GTGGTAAGGGGTGATAGTGTGGG + Intergenic
996650409 5:125869072-125869094 GTGATAATTGACAATATTGTAGG - Intergenic
996745002 5:126839962-126839984 GTGGTAAGGGGTGATATTGTGGG + Intergenic
996897866 5:128506273-128506295 GTTGGAAGACTCAATATTGTGGG - Intronic
996918165 5:128735364-128735386 GGGGTAAGGGGTGATATTGTGGG - Intronic
997746789 5:136306365-136306387 GTGGTAAAGGGTGATATTGTGGG - Intronic
997769462 5:136541557-136541579 GTGGTAAAGGGTGATATTGTGGG + Intergenic
997770230 5:136546943-136546965 GTGGTAAGGGGTGATATTGTGGG + Intergenic
997772258 5:136565962-136565984 GTGGTAAGGGGTGATATTGTGGG + Intergenic
998633351 5:143925553-143925575 GTGGTAAGGGGTGATATTGTGGG + Intergenic
998995775 5:147868383-147868405 GTGGTAAGGGGTGATATTGTGGG - Intergenic
999618482 5:153450315-153450337 GTGGTAAGGGGTGATATTGTGGG + Intergenic
999709460 5:154303541-154303563 GTGGGAAGAGGAACTATTTTTGG - Intronic
1000364704 5:160479964-160479986 GTGGTAAAAGGCCACATTGAGGG + Intergenic
1000439017 5:161245607-161245629 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1000440202 5:161254403-161254425 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1000519007 5:162276021-162276043 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1000742765 5:164990427-164990449 GTGCTAGAAGACAATATTGTAGG + Intergenic
1000885034 5:166740625-166740647 GTGGTGAGGGGTGATATTGTGGG + Intergenic
1000935174 5:167298218-167298240 GTGGTAAGGGGTGATATTGTGGG + Intronic
1001069548 5:168572929-168572951 GTGGTAAGGGGTGATATTGTGGG + Intronic
1001331067 5:170762667-170762689 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1001353775 5:171001216-171001238 GGGGTAAGGGGTGATATTGTGGG + Intronic
1002390806 5:178910294-178910316 GTGGGAAGATGCAATTTTGGAGG - Intronic
1002610680 5:180416340-180416362 GTGGTAAGGGGTGACATTGTGGG + Intergenic
1003429784 6:6028419-6028441 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1004106658 6:12672452-12672474 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1004283123 6:14297573-14297595 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1004507609 6:16259609-16259631 GTGGTAAGGGTTGATATTGTGGG + Intronic
1004768180 6:18754716-18754738 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1004837439 6:19544208-19544230 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1005014261 6:21362124-21362146 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1005567212 6:27108281-27108303 ATGGTAAGAGGAAATGTTTTGGG + Intergenic
1005582615 6:27248944-27248966 GAGGTAAGAGGCAATGTTGGGGG + Exonic
1005785934 6:29246100-29246122 GTGGTAAGGGGTGATATCGTGGG + Intergenic
1005805388 6:29469704-29469726 GTGGTGAGAGCCAACATTCTTGG - Intergenic
1006325569 6:33351223-33351245 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1007083035 6:39122343-39122365 GGGGTAAGGGGTGATATTGTGGG - Intergenic
1007300185 6:40862003-40862025 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1007639682 6:43328168-43328190 TTTGTTAGAGGCTATATTGTAGG - Intronic
1008477034 6:51943779-51943801 GTGGTAAGGGGTGATATTGTGGG - Intronic
1009270279 6:61605621-61605643 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1009343977 6:62591126-62591148 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1009359754 6:62796840-62796862 GTGGTAAGGGGTCATATTGTGGG - Intergenic
1009379592 6:63010837-63010859 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1009464845 6:63955960-63955982 GTGGTAAGGGGTGATATTGTGGG - Intronic
1009591228 6:65673330-65673352 GTGGTAAGAGGCAATATTGTGGG + Intronic
1009749743 6:67868249-67868271 ATGGTAAGGGGCAATACTGTGGG + Intergenic
1010071286 6:71748987-71749009 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1010545551 6:77150982-77151004 GTGGTAAGAGGTATTATAGTGGG + Intergenic
1010585934 6:77658640-77658662 GTGGTAAAGGGTGATATTGTGGG + Intergenic
1010662607 6:78587811-78587833 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1010748589 6:79592553-79592575 GTGGGAGGAGGCAGTATTCTAGG + Intergenic
1010826565 6:80483411-80483433 GTGGTAAGGGGTGATATTCTGGG + Intergenic
1010829250 6:80510386-80510408 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1010840874 6:80648127-80648149 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1010870969 6:81038440-81038462 GTGTTAAGAGCCAGTATTGCTGG - Intergenic
1010894037 6:81344541-81344563 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1011367479 6:86598827-86598849 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1011770552 6:90670829-90670851 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1012014008 6:93830744-93830766 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1012066146 6:94554551-94554573 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1012316203 6:97784667-97784689 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1012675548 6:102107552-102107574 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1012689802 6:102296691-102296713 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1013114223 6:107088894-107088916 GTGGTAAGTGGTAAGATTATAGG - Intronic
1013407495 6:109856367-109856389 GTGGTAAGGGGTGATATCGTGGG + Intergenic
1013807603 6:114012464-114012486 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1013843320 6:114423072-114423094 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1013892101 6:115036965-115036987 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1014396465 6:120930265-120930287 GTGGTAAGGAGTGATATTGTGGG - Intergenic
1014454481 6:121621052-121621074 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1014556241 6:122844914-122844936 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1014612490 6:123561738-123561760 GTGGTAAGGGGTGATATTGTGGG - Intronic
1014614277 6:123582915-123582937 GTGGTAAGGGGTGATATTGTGGG + Intronic
1014719287 6:124897127-124897149 GTGGTAAGGGATGATATTGTGGG - Intergenic
1014793595 6:125702481-125702503 GTGGTAAGGGATGATATTGTGGG + Intergenic
1014891929 6:126853821-126853843 GTGATAAGGGGTGATATTGTGGG - Intergenic
1015165629 6:130197616-130197638 GTGGTAAGGGGTGATATTGTGGG - Intronic
1015267134 6:131300542-131300564 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1015270035 6:131328487-131328509 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1015271748 6:131343909-131343931 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1015278546 6:131407909-131407931 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1015287663 6:131504960-131504982 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1015324215 6:131906764-131906786 GTGGTAAGGGGTGTTATTGTGGG - Intergenic
1015800839 6:137060877-137060899 GTGGTAAGAGGTGATATTGTGGG + Intergenic
1016113753 6:140258086-140258108 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1016205229 6:141460088-141460110 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1016249295 6:142021127-142021149 GTGGTACGGGGTGATATTGTGGG - Intergenic
1016519189 6:144928221-144928243 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1016535362 6:145103770-145103792 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1016649912 6:146451084-146451106 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1016751049 6:147631141-147631163 GTGGTAAGGGGTGATATTGTGGG + Intronic
1016853668 6:148644895-148644917 GTGGTAAGGGGTGACATTGTGGG - Intergenic
1017349043 6:153418366-153418388 GTAGTAAATGGCAATATTGCAGG - Intergenic
1017389897 6:153926572-153926594 GCGGTAAGGGGTGATATTGTGGG - Intergenic
1017778951 6:157701271-157701293 GTGGTAAGGGGTGATATTGTGGG + Intronic
1017922012 6:158880988-158881010 GGGGTAAGGGGTGATATTGTGGG + Intronic
1018084109 6:160287193-160287215 CTGGTAAGGGGTGATATTGTGGG + Intergenic
1018495004 6:164339360-164339382 ATGGTAAGGGGTGATATTGTGGG + Intergenic
1018521082 6:164652733-164652755 GTGGTAAGGGGTGACATTGTGGG + Intergenic
1020316375 7:6908379-6908401 GTGGTAAGGGGTGATATCGTGGG - Intergenic
1020322359 7:6948781-6948803 GTGGTAAGGGGTGATATTGTAGG + Intergenic
1020532318 7:9354038-9354060 TTGGTAAGGGGTGATATTGTGGG + Intergenic
1020540628 7:9458334-9458356 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1020794630 7:12664933-12664955 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1021042017 7:15873553-15873575 GTTGTCAGAGGCAATTTTGGAGG + Intergenic
1021053651 7:16020263-16020285 GTGGTAAGAGACAAGTTTGTAGG + Intergenic
1021067483 7:16194999-16195021 GTGGGATGAGGCAATAATGGTGG - Intronic
1021173242 7:17420129-17420151 GTGGTAAGGTGTGATATTGTGGG - Intergenic
1021394067 7:20125896-20125918 GTGGCAAGGGGTGATATTGTGGG - Intergenic
1021430309 7:20551086-20551108 GTGGCAAGGGGTGATATTGTGGG - Intergenic
1021637781 7:22708716-22708738 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1021661059 7:22918349-22918371 GTGGTAAGGGATGATATTGTGGG - Intergenic
1021811038 7:24401341-24401363 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1021977515 7:26024819-26024841 GTGGTAAAGGGTGATATTGTGGG + Intergenic
1022008439 7:26288625-26288647 GTGGGAGGAGGCAATCTTGTGGG - Intergenic
1022373538 7:29791923-29791945 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1022572366 7:31467443-31467465 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1022709493 7:32837669-32837691 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1022709737 7:32839365-32839387 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1022854359 7:34300749-34300771 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1023698497 7:42871229-42871251 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1026364533 7:69634506-69634528 TTGGGTAGAGGAAATATTGTAGG + Intronic
1027158875 7:75787959-75787981 GTGGTAAGGGGCGATATTGTGGG - Intronic
1027354872 7:77345246-77345268 GTGGTAAGGGGTGATATTGTGGG - Intronic
1027797493 7:82712803-82712825 CTGGTTAGAGGCAATACTTTAGG + Intergenic
1027852347 7:83464737-83464759 GTGGTAAGGGGTGATATTGTGGG - Intronic
1028159785 7:87473036-87473058 GTGGTGTCAGGCAATCTTGTTGG + Intronic
1028589388 7:92479768-92479790 GTGGTAAGGGGCGATATTGTGGG + Intergenic
1028603407 7:92628299-92628321 ATGGCAAGAGGCAATGTTGTCGG - Intronic
1028670891 7:93399008-93399030 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1028690557 7:93644942-93644964 GTGGTAAGGGGTGATATTATGGG - Intronic
1029500653 7:100927402-100927424 GTGGTAAGGGGTGATATCGTGGG - Intergenic
1030167015 7:106565363-106565385 GTGGCTAGAGGAAAAATTGTTGG - Intergenic
1030194301 7:106837883-106837905 GGGGTAAGGGGTGATATTGTGGG - Intergenic
1030441265 7:109592445-109592467 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1030445352 7:109642314-109642336 GTGGTAAGGGATAATATTGTGGG + Intergenic
1030751224 7:113235085-113235107 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1031005049 7:116460538-116460560 GTGGTAAGGGGTGATATTGTGGG - Intronic
1031297034 7:120014176-120014198 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1031354734 7:120777206-120777228 GTGGTAAGAGGTGATATTGTGGG + Intergenic
1031364380 7:120886250-120886272 GTGGTAAGGGGTGATGTTGTGGG + Intergenic
1031400371 7:121320650-121320672 GTGGCAAGGGGTGATATTGTGGG - Intergenic
1031422019 7:121564229-121564251 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1031526040 7:122822346-122822368 GTGGTAAGGGGTGATATTGTGGG - Intronic
1031686234 7:124734121-124734143 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1031704183 7:124961249-124961271 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1031776706 7:125915086-125915108 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1031777843 7:125923497-125923519 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1033085077 7:138333894-138333916 GTGGTAAGGGATAATATCGTGGG - Intergenic
1033088966 7:138367664-138367686 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1033212026 7:139467086-139467108 GTGGTAAGGGGCGATATTGTGGG - Intronic
1033625964 7:143109921-143109943 GGGGTAAGGGGTGATATTGTGGG - Intergenic
1033675560 7:143537848-143537870 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1033696276 7:143791596-143791618 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1033909078 7:146244000-146244022 GTGGTAAGGGGTGATATTGTGGG + Intronic
1034084330 7:148310008-148310030 GTGGTAAGGGGTGATATTGTGGG + Intronic
1035880232 8:3238587-3238609 GTGGTAAGGGGTGATATTGTGGG + Intronic
1036281867 8:7407517-7407539 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1036339604 8:7904054-7904076 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1036373818 8:8183258-8183280 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1036471858 8:9059494-9059516 GTGGAAAGGGGTGATATTGTGGG + Intronic
1036639924 8:10576735-10576757 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1036877085 8:12482383-12482405 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1039143510 8:34419755-34419777 GTGGTAACAGGCATGACTGTAGG + Intergenic
1040648549 8:49425760-49425782 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1041916994 8:63147980-63148002 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1041917023 8:63148222-63148244 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1042453935 8:68978110-68978132 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1042707763 8:71680009-71680031 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1043353275 8:79386721-79386743 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1043596985 8:81898576-81898598 GTGGTAGGGGGTGATATTGTGGG + Intergenic
1043599399 8:81919320-81919342 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1043717452 8:83505278-83505300 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1043838173 8:85068543-85068565 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1044148131 8:88742832-88742854 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1044258234 8:90090839-90090861 GTGGTAAGGGGTGATATTGTGGG + Intronic
1044417358 8:91952057-91952079 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1044922372 8:97180093-97180115 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1044922862 8:97184491-97184513 GTGGTAATAGGCAAGTGTGTTGG + Intergenic
1044925554 8:97206001-97206023 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1045197918 8:99948972-99948994 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1045533266 8:103003996-103004018 GTGGTAAGGGGCAATATTGTGGG - Intergenic
1045645252 8:104291476-104291498 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1045911291 8:107413418-107413440 GAGGTATGAGGGAATACTGTTGG + Intronic
1046075453 8:109306826-109306848 GGGGTAAGGGGTGATATTGTGGG - Intronic
1046294513 8:112200851-112200873 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1046385972 8:113510231-113510253 GTGGTAATGGGTGATATTGTGGG + Intergenic
1046440403 8:114246431-114246453 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1046443647 8:114287085-114287107 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1046512473 8:115217323-115217345 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1046559560 8:115818809-115818831 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1046900324 8:119516707-119516729 TTGGTAAGAAACAATATTGTTGG + Intergenic
1047699743 8:127436810-127436832 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1047829152 8:128612534-128612556 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1047856809 8:128919704-128919726 GTGGTAAGGGGTGATACTGTGGG - Intergenic
1048097986 8:131315294-131315316 GTGGTAAGGGGTGATACTGTGGG - Intergenic
1048135878 8:131746022-131746044 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1048144202 8:131824492-131824514 GTGGTAAGGGGTGATACTGTGGG - Intergenic
1048168053 8:132080866-132080888 GTGGTAAGGGGTGATATTGTGGG + Intronic
1048585045 8:135767799-135767821 GTGGTAAGGGGTGATACTGTGGG + Intergenic
1048763802 8:137825226-137825248 GTGGTAAGGGGTGATACTGTGGG + Intergenic
1049868379 8:144954501-144954523 GTGGTAAGGGATGATATTGTGGG + Intergenic
1050056295 9:1659226-1659248 GTTGCAAGAGGCAATATGGTTGG + Intergenic
1050257639 9:3811485-3811507 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1050896500 9:10890109-10890131 GTGGTAAGGGGTGATACTGTGGG - Intergenic
1051053024 9:12953448-12953470 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1051849094 9:21487915-21487937 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1052163566 9:25293540-25293562 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1052192291 9:25674561-25674583 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1052219253 9:25999362-25999384 GGGGTAAGGGGTGATATTGTGGG - Intergenic
1052654089 9:31334045-31334067 GTGGTAAAGGGTGATATTGTGGG - Intergenic
1052720221 9:32164953-32164975 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1053058446 9:35008773-35008795 GTGGTAAGGGGTGATATCGTGGG - Intergenic
1054807038 9:69405158-69405180 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1055233458 9:74090756-74090778 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1055347235 9:75351737-75351759 GTGGTAAGGGGTGATACTGTGGG + Intergenic
1055627179 9:78186205-78186227 GTGGAAAGGGGTGATATTGTCGG - Intergenic
1055810448 9:80142508-80142530 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1055882192 9:81014667-81014689 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1055919810 9:81447905-81447927 GTGGGTAGAATCAATATTGTGGG - Intergenic
1056044431 9:82702168-82702190 GTGGTGAGGGGTGATATTGTGGG + Intergenic
1056061545 9:82888836-82888858 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1056324644 9:85466291-85466313 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1056363246 9:85879799-85879821 GTGGTAAGGGGCGATATTGTGGG + Intergenic
1056522837 9:87416020-87416042 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1056883365 9:90417672-90417694 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1057235233 9:93352695-93352717 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1057684307 9:97219325-97219347 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1057812085 9:98265904-98265926 GTGGTAAGGGATGATATTGTGGG + Intergenic
1057982478 9:99675246-99675268 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1058025736 9:100140772-100140794 GTGGTAAGGGGTGATATTGTGGG + Intronic
1058612819 9:106793649-106793671 GTGGTAAGGGGTGATATTATGGG - Intergenic
1059545782 9:115175244-115175266 GTGGTAAGGGGTGATATTGTGGG + Intronic
1059574981 9:115478265-115478287 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1059606313 9:115839811-115839833 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1059680298 9:116579478-116579500 ATGGTAAGAGAAAATGTTGTAGG - Intronic
1059863086 9:118486269-118486291 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1060226712 9:121796115-121796137 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1060318039 9:122531189-122531211 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1060737441 9:126075029-126075051 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1061583362 9:131551324-131551346 GTGGTAAGAGGTGATATTGTGGG - Intergenic
1062692468 9:137849829-137849851 ATGGTAAGGGGTGATATTGTGGG - Intronic
1185858027 X:3553753-3553775 GTGGTAAGGGGTGATATCGTGGG + Intergenic
1185991465 X:4896683-4896705 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1186112455 X:6272809-6272831 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1186784475 X:12944923-12944945 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1187086130 X:16045310-16045332 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1187103362 X:16217436-16217458 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1187233658 X:17446100-17446122 GTGGTAAGGGGTGATATCGTGGG - Intronic
1187289316 X:17937688-17937710 GAGGTATGAGGGAATATTTTGGG - Intergenic
1187937082 X:24346681-24346703 GTAGTAAATGGCAATATTGCAGG - Intergenic
1188332541 X:28892755-28892777 GTGGTAAGGGGTGATATTGTGGG + Intronic
1188419942 X:29980634-29980656 GTGGTAAGGGGTGGTATTGTGGG - Intergenic
1188431463 X:30108640-30108662 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1188462968 X:30449522-30449544 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1188512516 X:30951493-30951515 ATGGAAAAAGGCAATATTTTAGG + Intronic
1188553092 X:31382715-31382737 GTGGTAAGGGGTGATATTGTGGG - Intronic
1189136037 X:38551464-38551486 GTGGTAAGGGGCGATATTGTGGG - Intronic
1191013798 X:55788930-55788952 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1191762083 X:64656960-64656982 GTGGTAAGGGGTGGTATTGTGGG - Intergenic
1191805336 X:65129871-65129893 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1191826046 X:65365459-65365481 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1191950247 X:66583213-66583235 GTGTTAAGAGGGAAATTTGTAGG + Intergenic
1192455453 X:71272087-71272109 GGGGTAAGGGGTGATATTGTGGG - Intergenic
1192632615 X:72789150-72789172 GTGTGAAGAGGCAGAATTGTGGG + Intronic
1192649094 X:72931651-72931673 GTGTGAAGAGGCAGAATTGTGGG - Intronic
1192763727 X:74122176-74122198 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1192792739 X:74399297-74399319 CTGGTAAGATCAAATATTGTTGG + Intergenic
1193537539 X:82732314-82732336 GGGGTAAGTGGTGATATTGTGGG - Intergenic
1193618066 X:83714564-83714586 GTGTTAAGAGGTTATATTTTGGG - Intergenic
1193886315 X:86986882-86986904 GTGGTAAGGGGTGATATTGTTGG - Intergenic
1193941888 X:87686989-87687011 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1194109597 X:89817224-89817246 GTAGTAAATGGCAATATTGCAGG + Intergenic
1194185851 X:90773945-90773967 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1194293229 X:92100868-92100890 GTGGTAAGGGGTGATATTGTTGG + Intronic
1194308153 X:92273687-92273709 GTGGTAAGGGGTGATATTGTGGG + Intronic
1194351553 X:92828690-92828712 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1194367501 X:93028022-93028044 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1194502584 X:94699439-94699461 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1194661190 X:96629888-96629910 GTGGTAAGGGGTGATACTGTGGG - Intergenic
1194802282 X:98288584-98288606 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1194822380 X:98524880-98524902 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1194873303 X:99159304-99159326 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1195016538 X:100786967-100786989 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1195290687 X:103429635-103429657 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1195326359 X:103761711-103761733 GTGATAAGGGGTGATATTGTGGG + Intergenic
1195472285 X:105244372-105244394 GTAGTAAATGGCAATATTGCAGG - Intronic
1195841890 X:109183504-109183526 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1195908397 X:109866726-109866748 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1196002483 X:110801163-110801185 GTGCTAAGAGACAGTATTGAAGG - Intergenic
1196073474 X:111549017-111549039 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1196165931 X:112535699-112535721 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1196220574 X:113109335-113109357 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1196226730 X:113176780-113176802 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1196300423 X:114045381-114045403 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1196331223 X:114471856-114471878 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1196341323 X:114601907-114601929 GTGGTAAGGGGTGATATTGTGGG + Intronic
1196497301 X:116336240-116336262 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1196524984 X:116720906-116720928 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1196533165 X:116813105-116813127 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1196572885 X:117284238-117284260 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1196773473 X:119318397-119318419 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1197022435 X:121707518-121707540 TTGGTAAGAAGCAATTTGGTAGG + Intergenic
1197065298 X:122227130-122227152 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1197471399 X:126868378-126868400 GTGGTAAGGGGTAATATTGTGGG - Intergenic
1197500225 X:127232428-127232450 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1197553744 X:127928770-127928792 GTAGTAAATGGCAATATTGCAGG + Intergenic
1197579436 X:128263292-128263314 GTGGTAAGGGCTGATATTGTGGG + Intergenic
1197933486 X:131717151-131717173 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1198530336 X:137545927-137545949 GTGGTGAGAGGCAAGCTTGCTGG - Intergenic
1198598836 X:138263898-138263920 CTGGTAAGGGGTGATATTGTGGG - Intergenic
1198599010 X:138264937-138264959 CTGGTAAGGGGTGATATTGTGGG + Intergenic
1198890946 X:141395525-141395547 GGGGTAAGGGGTGATATTGTCGG + Intergenic
1198966441 X:142232423-142232445 GTGGTAAGGGGCGATATTGTGGG - Intergenic
1198983317 X:142423968-142423990 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1199073266 X:143502768-143502790 GTGGTAAGGGGCGATATTGTGGG + Intergenic
1199377588 X:147132257-147132279 GTGGTAAGAGACAATATTGTGGG + Intergenic
1199554063 X:149087449-149087471 GTCAAAAGAGGCAATGTTGTGGG - Intergenic
1200007226 X:153095176-153095198 GGGGTAAGGGGTGATATTGTGGG + Intergenic
1200462261 Y:3471964-3471986 GTAGTAAATGGCAATATTGCAGG + Intergenic
1200532467 Y:4356026-4356048 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1200610741 Y:5325413-5325435 GTGGTAAGGGGTGATATTGTGGG + Intronic
1200659875 Y:5945382-5945404 GTGGTAAGGGGTGATATCGTGGG - Intergenic
1200675710 Y:6144281-6144303 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1201061126 Y:10047703-10047725 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1201233553 Y:11889030-11889052 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1201307029 Y:12559780-12559802 GTGGTAAGGGGTGATATTGTGGG + Intergenic
1201604747 Y:15772384-15772406 GTGGTAAAGGGTGATATTGTGGG - Intergenic
1201937874 Y:19427031-19427053 GTGGTAAGGGGTGATATTGTGGG - Intergenic
1202062805 Y:20905160-20905182 TTGTTAAGGGGCAATATTGTGGG - Intergenic