ID: 1009602627

View in Genome Browser
Species Human (GRCh38)
Location 6:65821854-65821876
Sequence TAGTGGGAGTGGGGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009602618_1009602627 -6 Left 1009602618 6:65821837-65821859 CCAGAGGCTGAGAAGCGTAGTGG No data
Right 1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009602627 Original CRISPR TAGTGGGAGTGGGGGGAAGT GGG Intergenic
No off target data available for this crispr