ID: 1009615518

View in Genome Browser
Species Human (GRCh38)
Location 6:65999680-65999702
Sequence CGTCCACCTGGAACTCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009615513_1009615518 2 Left 1009615513 6:65999655-65999677 CCGAGTGCAGGGCCCGCTGAGGC No data
Right 1009615518 6:65999680-65999702 CGTCCACCTGGAACTCACGCTGG No data
1009615508_1009615518 15 Left 1009615508 6:65999642-65999664 CCGGCCAGCGGCTCCGAGTGCAG No data
Right 1009615518 6:65999680-65999702 CGTCCACCTGGAACTCACGCTGG No data
1009615514_1009615518 -10 Left 1009615514 6:65999667-65999689 CCCGCTGAGGCCACGTCCACCTG No data
Right 1009615518 6:65999680-65999702 CGTCCACCTGGAACTCACGCTGG No data
1009615511_1009615518 11 Left 1009615511 6:65999646-65999668 CCAGCGGCTCCGAGTGCAGGGCC No data
Right 1009615518 6:65999680-65999702 CGTCCACCTGGAACTCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009615518 Original CRISPR CGTCCACCTGGAACTCACGC TGG Intergenic
No off target data available for this crispr