ID: 1009617507

View in Genome Browser
Species Human (GRCh38)
Location 6:66029432-66029454
Sequence TATTATACTCAGAAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009617507_1009617510 7 Left 1009617507 6:66029432-66029454 CCTTCCAGTTTCTGAGTATAATA No data
Right 1009617510 6:66029462-66029484 CAATTCTTTTTGTTGTTGGCTGG No data
1009617507_1009617511 20 Left 1009617507 6:66029432-66029454 CCTTCCAGTTTCTGAGTATAATA No data
Right 1009617511 6:66029475-66029497 TGTTGGCTGGAGTATAGAAATGG No data
1009617507_1009617509 3 Left 1009617507 6:66029432-66029454 CCTTCCAGTTTCTGAGTATAATA No data
Right 1009617509 6:66029458-66029480 TTTTCAATTCTTTTTGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009617507 Original CRISPR TATTATACTCAGAAACTGGA AGG (reversed) Intergenic
No off target data available for this crispr