ID: 1009617735

View in Genome Browser
Species Human (GRCh38)
Location 6:66032179-66032201
Sequence GGTGCTCAGAGGTTCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009617735_1009617744 24 Left 1009617735 6:66032179-66032201 CCAACAGAGAACCTCTGAGCACC No data
Right 1009617744 6:66032226-66032248 CTGCAGTTATCCATGGGGAGTGG No data
1009617735_1009617745 27 Left 1009617735 6:66032179-66032201 CCAACAGAGAACCTCTGAGCACC No data
Right 1009617745 6:66032229-66032251 CAGTTATCCATGGGGAGTGGAGG No data
1009617735_1009617742 19 Left 1009617735 6:66032179-66032201 CCAACAGAGAACCTCTGAGCACC No data
Right 1009617742 6:66032221-66032243 AAAGCCTGCAGTTATCCATGGGG No data
1009617735_1009617741 18 Left 1009617735 6:66032179-66032201 CCAACAGAGAACCTCTGAGCACC No data
Right 1009617741 6:66032220-66032242 AAAAGCCTGCAGTTATCCATGGG No data
1009617735_1009617740 17 Left 1009617735 6:66032179-66032201 CCAACAGAGAACCTCTGAGCACC No data
Right 1009617740 6:66032219-66032241 AAAAAGCCTGCAGTTATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009617735 Original CRISPR GGTGCTCAGAGGTTCTCTGT TGG (reversed) Intergenic
No off target data available for this crispr