ID: 1009619887

View in Genome Browser
Species Human (GRCh38)
Location 6:66062547-66062569
Sequence AACTATATGCTGTCCTACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009619887_1009619890 29 Left 1009619887 6:66062547-66062569 CCCTTGTAGGACAGCATATAGTT No data
Right 1009619890 6:66062599-66062621 GATAGTATGCTGACATGGTCTGG No data
1009619887_1009619889 24 Left 1009619887 6:66062547-66062569 CCCTTGTAGGACAGCATATAGTT No data
Right 1009619889 6:66062594-66062616 TCTGTGATAGTATGCTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009619887 Original CRISPR AACTATATGCTGTCCTACAA GGG (reversed) Intergenic