ID: 1009628122

View in Genome Browser
Species Human (GRCh38)
Location 6:66162775-66162797
Sequence CTCAAAATCCAATAGCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009628122_1009628125 4 Left 1009628122 6:66162775-66162797 CCCTGTAGCTATTGGATTTTGAG No data
Right 1009628125 6:66162802-66162824 AAATTCATTTGGACCTCTCATGG No data
1009628122_1009628126 5 Left 1009628122 6:66162775-66162797 CCCTGTAGCTATTGGATTTTGAG No data
Right 1009628126 6:66162803-66162825 AATTCATTTGGACCTCTCATGGG No data
1009628122_1009628124 -7 Left 1009628122 6:66162775-66162797 CCCTGTAGCTATTGGATTTTGAG No data
Right 1009628124 6:66162791-66162813 TTTTGAGCTTTAAATTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009628122 Original CRISPR CTCAAAATCCAATAGCTACA GGG (reversed) Intergenic
No off target data available for this crispr