ID: 1009628239

View in Genome Browser
Species Human (GRCh38)
Location 6:66163767-66163789
Sequence GGTCCAGCCCTGATATTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009628237_1009628239 -9 Left 1009628237 6:66163753-66163775 CCTCTTCTTGGAGAGGTCCAGCC No data
Right 1009628239 6:66163767-66163789 GGTCCAGCCCTGATATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009628239 Original CRISPR GGTCCAGCCCTGATATTTGG TGG Intergenic
No off target data available for this crispr