ID: 1009630768

View in Genome Browser
Species Human (GRCh38)
Location 6:66197553-66197575
Sequence ATAGAGTAGACCTATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009630768_1009630770 -5 Left 1009630768 6:66197553-66197575 CCATCCTCATAGGTCTACTCTAT No data
Right 1009630770 6:66197571-66197593 TCTATTAAGAGATAAGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009630768 Original CRISPR ATAGAGTAGACCTATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr