ID: 1009633486

View in Genome Browser
Species Human (GRCh38)
Location 6:66232181-66232203
Sequence CAGTGAAGGACTTTGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009633482_1009633486 -8 Left 1009633482 6:66232166-66232188 CCAGCATCTGGTGTCCAGTGAAG No data
Right 1009633486 6:66232181-66232203 CAGTGAAGGACTTTGGCAGATGG No data
1009633480_1009633486 6 Left 1009633480 6:66232152-66232174 CCAAGATTGAGATGCCAGCATCT No data
Right 1009633486 6:66232181-66232203 CAGTGAAGGACTTTGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009633486 Original CRISPR CAGTGAAGGACTTTGGCAGA TGG Intergenic
No off target data available for this crispr