ID: 1009635769

View in Genome Browser
Species Human (GRCh38)
Location 6:66262617-66262639
Sequence GGCATAAAAGCTCTACATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 3, 1: 35, 2: 49, 3: 38, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009635769_1009635775 0 Left 1009635769 6:66262617-66262639 CCCCCATGTAGAGCTTTTATGCC 0: 3
1: 35
2: 49
3: 38
4: 101
Right 1009635775 6:66262640-66262662 ATAGTTGGTCCAACATTCTGTGG No data
1009635769_1009635777 17 Left 1009635769 6:66262617-66262639 CCCCCATGTAGAGCTTTTATGCC 0: 3
1: 35
2: 49
3: 38
4: 101
Right 1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG No data
1009635769_1009635778 21 Left 1009635769 6:66262617-66262639 CCCCCATGTAGAGCTTTTATGCC 0: 3
1: 35
2: 49
3: 38
4: 101
Right 1009635778 6:66262661-66262683 GGACCACTAACGAGCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009635769 Original CRISPR GGCATAAAAGCTCTACATGG GGG (reversed) Intergenic
901946336 1:12707022-12707044 AGCATAAAAGCTCCACATTGGGG + Intergenic
902051983 1:13570988-13571010 GGCATAAAAGCTTTACATCGGGG - Intergenic
902886217 1:19406702-19406724 GGCATAAAAGATCAACCTTGTGG + Intronic
904176858 1:28635960-28635982 GGCATAAAAGCCCTATACTGTGG + Intronic
904712957 1:32444793-32444815 GGCATAAAAGCTCTACATCGAGG + Intergenic
905061154 1:35140177-35140199 GGCATGAAAGCTCTACATCGGGG + Intergenic
909150915 1:72003556-72003578 GAAAAAAAAGCTCTAAATGGAGG + Intronic
910852955 1:91666531-91666553 GGCATGAAAGCTCTACATCAGGG + Intergenic
912816024 1:112829319-112829341 GGCATAAAAGCTCTAAATTGGGG - Intergenic
912905218 1:113698866-113698888 GGTATAAAACCACCACATGGTGG + Intronic
912980414 1:114366037-114366059 GGCATAAAAGCTCTACATCAGGG + Intergenic
917311759 1:173686018-173686040 AGCATAAAAGCTCTACATCAGGG + Intergenic
917444326 1:175094180-175094202 GGCATACAAGGTCTACGTGTGGG + Exonic
918398882 1:184144097-184144119 GGCATACAACCTCTTTATGGGGG + Intergenic
919646815 1:200103418-200103440 GTCCTAAAAGCTTTACATGCAGG - Intronic
922680769 1:227593462-227593484 GGCATGAAAGCTCTACATTGGGG + Intronic
922690156 1:227682642-227682664 GGCATGAAAGCTCTACATCGGGG - Intergenic
924441107 1:244086255-244086277 GGAATAACAGCTCTCCCTGGGGG + Intergenic
924859071 1:247902406-247902428 GGCAGGGAAGCTCTACATCGGGG + Intergenic
1062861573 10:814514-814536 GAAATAAAAGGACTACATGGTGG + Intronic
1064756514 10:18576412-18576434 GGCATAAAAGCTCTACATTGAGG - Intronic
1065931007 10:30479109-30479131 GGCATAAAAGCTCTACATTGGGG - Intergenic
1066475179 10:35739745-35739767 GTCATAAAATTTTTACATGGAGG - Intergenic
1068671796 10:59730552-59730574 GGCATGAAAGTTCTACATCGGGG + Intronic
1069421781 10:68252974-68252996 GGCAGAAGAGCTCTATGTGGGGG + Intergenic
1069939248 10:71943120-71943142 GGCATAAAAGCTCTACATCAGGG - Intergenic
1071283128 10:84120758-84120780 GGCATAAAAGCACTACATCAGGG + Intergenic
1072334802 10:94388513-94388535 AGCATAAAAGCTCTACACTGGGG - Intergenic
1074755922 10:116624109-116624131 GGCATGTAAGCGCTGCATGGTGG + Intronic
1076612403 10:131734591-131734613 GGCATGGAAGCTCTAGATGCTGG + Intergenic
1076612424 10:131734761-131734783 GGCATGGAAGCTCTAGATGCTGG + Intergenic
1076612427 10:131734795-131734817 GGCATGGAAGCTCTAGATGCTGG + Intergenic
1076612447 10:131734965-131734987 GGCATGGAGGCTCTACATGCTGG + Intergenic
1082634992 11:55584276-55584298 GGCCTACAAGCTCTGCTTGGGGG - Intergenic
1083082198 11:60105447-60105469 GGCATAAAAGCTCTACATCGGGG + Intergenic
1083089893 11:60189097-60189119 GGCATAAAAGTTCTACATTGGGG - Intergenic
1085239783 11:75043720-75043742 AGCATAAAAGCTCTACATTGGGG - Intergenic
1086973462 11:93107592-93107614 GGCATAAAAGCTCTACATCGGGG + Intergenic
1087456800 11:98396783-98396805 AACATAAAAGCTCTACATCATGG + Intergenic
1087894810 11:103575702-103575724 GGCATAAAAGCTCTACATCGGGG - Intergenic
1088131483 11:106497381-106497403 GTCATAAAAGGTTTCCATGGAGG - Intergenic
1091814516 12:3426428-3426450 GGCATAAAAGCTCTACATCTGGG + Intronic
1093356746 12:18176334-18176356 GGCATAAAAGCTCTACATTGGGG - Intronic
1093594112 12:20941121-20941143 GGCATAAATGCTCTACAATGGGG + Intergenic
1096207721 12:49737432-49737454 AGCATAAAAGCTCTACATTGTGG - Intronic
1098248393 12:68543878-68543900 GGCATAAAAGCTCTACACTGGGG - Intergenic
1101672768 12:106892163-106892185 GGAATAAAAGCTCTAATTTGTGG - Intergenic
1102314831 12:111879320-111879342 TGTGTAAAAGCTCTATATGGTGG + Intronic
1102606385 12:114070935-114070957 GGCATAAAAGCTCTACATCAGGG - Intergenic
1103728286 12:123009904-123009926 CGCATACAAGCTCTGCAAGGTGG - Exonic
1104036560 12:125101457-125101479 GGCATAAATGCACTGCTTGGAGG + Intronic
1105569468 13:21588061-21588083 GGCATAAAAGCTCTACATCGGGG - Intronic
1106290115 13:28353126-28353148 GGCACAAAAGGACTACATGAGGG - Intronic
1109786833 13:67187117-67187139 GGCATCAAAGCTGAACATGATGG + Intronic
1109909496 13:68890968-68890990 AGCATAAAAGCTCTACTTCGGGG + Intergenic
1110117228 13:71834451-71834473 GGCACAATAGCTCTAGATAGTGG - Intronic
1110149509 13:72233174-72233196 GGCACATAAATTCTACATGGAGG - Intergenic
1110653709 13:77972505-77972527 GGCATAAAAGCTCTATGTTGGGG + Intergenic
1114116695 14:19629645-19629667 TGGCTAAAAGCTCTAAATGGAGG - Intergenic
1114236087 14:20824919-20824941 GGCATAAAAGCTCTACATCGGGG + Intergenic
1115204857 14:30891442-30891464 GGAATAAAAGGACTACATGCAGG + Intronic
1115211365 14:30970325-30970347 GGCATAAAAGCTCTACATCGGGG - Intronic
1115460467 14:33654450-33654472 GACATAAAATATCTACCTGGTGG - Intronic
1116453928 14:45095975-45095997 GGCTTAAAAACTCCACATGCAGG - Intronic
1117179542 14:53177958-53177980 GGCATAAAAGCTGTACATCTGGG + Intergenic
1117955197 14:61117443-61117465 GGCATGAAAGCTCTACACTGGGG + Intergenic
1117966401 14:61211012-61211034 GGAATGAAAGCTGAACATGGAGG + Intronic
1119825173 14:77651675-77651697 GTCATACAAGCTCTACATATAGG - Intergenic
1124718072 15:32085282-32085304 GGGATAAAGGGCCTACATGGGGG - Intronic
1133435086 16:5772301-5772323 GGCGTACAGACTCTACATGGAGG - Intergenic
1135625131 16:23988387-23988409 GGCATAAAGGCTTTACTTGTTGG + Intronic
1137041603 16:35617689-35617711 AGCATAAAAGCTCTACATCTGGG + Intergenic
1138798179 16:59994624-59994646 AGAATAAAAGCTCTAAATGAAGG - Intergenic
1144861556 17:18306651-18306673 GGAATAAAGGCTGGACATGGTGG - Intronic
1147810307 17:43164279-43164301 GGCATAAAAACTCTACATCAGGG + Intergenic
1148828965 17:50416791-50416813 GGCATAAAAGCTCTACATTGGGG + Intergenic
1152454946 17:80409416-80409438 GGCATAAAAGCTCTACATTGGGG - Intergenic
1153826379 18:8878775-8878797 GGCATAAAAGCACTACATCCGGG + Intergenic
1154014133 18:10601479-10601501 GGCATTAAAGCTCTACATTGGGG + Intergenic
1155637452 18:27972824-27972846 GACATAAAAGCTCAAAATAGAGG + Intronic
1158747834 18:60221986-60222008 GGCATCAACACTATACATGGGGG - Intergenic
1162267809 19:9590170-9590192 GGCATAAAAGCTCTACATCGGGG + Intergenic
1162281900 19:9705454-9705476 GGCATGAAAGCTCTACATTGTGG - Intergenic
1163867090 19:19782568-19782590 AGCATAAAAGCTCTACGTTGGGG + Intergenic
1163991849 19:21006296-21006318 GGCATAAAAGCTCTACATTGGGG - Intergenic
1164121569 19:22269936-22269958 GGCATAAAAGCTCTACATTGGGG + Intergenic
1164130723 19:22358867-22358889 GGCATAAAAGCTCTACATTGGGG + Intergenic
1166426488 19:42683504-42683526 GGCAGACATGTTCTACATGGAGG - Intronic
1166989540 19:46683144-46683166 GGAATCAAAGCCCGACATGGTGG - Intronic
925438149 2:3859306-3859328 GGAATAAAAGCTGGCCATGGGGG - Intergenic
929631964 2:43472322-43472344 GACATAAATGCTATAAATGGTGG + Intronic
933138619 2:78765733-78765755 GGCATAAAAGCTGTCCTTAGAGG - Intergenic
933389465 2:81652076-81652098 GGCATAAAAGCTCTACATCGGGG + Intergenic
935048415 2:99502582-99502604 GGCATAAAAGCTCTATATCGGGG - Intergenic
935721487 2:105983186-105983208 GGCATAAAAGCTCTACATTGAGG + Intergenic
935970584 2:108527376-108527398 GGCATGAAAGGTCTACATGGGGG - Intergenic
936419598 2:112350514-112350536 GGCATGAAAGGTCTACATGGGGG + Intergenic
938703165 2:133897427-133897449 GGCATAAAAGCTCTACATTCAGG - Intergenic
943036466 2:182752078-182752100 GGTAGTAAAGCTCGACATGGTGG - Exonic
943408090 2:187514039-187514061 GGCATAAAAGCTCTACATCGGGG - Intronic
944027289 2:195186514-195186536 GGCATAAAAACATAACATGGAGG - Intergenic
944410408 2:199435863-199435885 GAGTTAAAAGCTCTAAATGGGGG - Intronic
945289740 2:208115454-208115476 GGCATAAAAGCTCTACATTGAGG - Intergenic
945720286 2:213410476-213410498 AGCATAAAAGCTCTACATCGGGG - Intronic
946823000 2:223649115-223649137 TGCATAACAGCTCTAATTGGGGG + Intergenic
1168849150 20:964636-964658 GACATAAAAGTTCTTCATAGGGG + Intronic
1175513873 20:59555656-59555678 GGCATGAAAGCTCTACATCGGGG + Intergenic
1178720576 21:35005709-35005731 GCTATAAATGCTGTACATGGAGG + Intronic
1179670883 21:42946834-42946856 GGCATGAAAGCTCTACGTCAGGG + Intergenic
1182916237 22:34034882-34034904 TGCATAGAAGCCCAACATGGAGG - Intergenic
949610945 3:5702834-5702856 AGCATAAAAGCTCTACATTAGGG + Intergenic
950594292 3:13965236-13965258 GGCATAAAAGCTCTGGATTGGGG + Intronic
950846140 3:16017759-16017781 GGCATAAAAGCTCTACATCGGGG + Intergenic
951248550 3:20368059-20368081 AGCATGAAAGCTCTACATCGGGG + Intergenic
952184494 3:30953958-30953980 GGAAGACAAGCTCCACATGGAGG + Intergenic
954604742 3:51900627-51900649 GGTATAAAAGCTCTACATCGCGG - Intronic
955749651 3:62174911-62174933 GGGTTAAAAACTCTCCATGGGGG - Intronic
955912555 3:63872822-63872844 GGGATAACAGCTCTACATGTAGG + Intronic
957999919 3:87737651-87737673 GGCATGAAAGCTCTACATCGGGG + Intergenic
960720357 3:120619189-120619211 GGCATAAAAGCTCTACATCAGGG + Intergenic
962096746 3:132300151-132300173 GGCATGAAAGCTCTACATCGGGG + Intergenic
962097372 3:132306316-132306338 GGCATAAAAGCTCTATGTTGAGG - Intergenic
962277068 3:134023538-134023560 GGCATGAAAGCTCTACATCGGGG - Intronic
962797409 3:138861313-138861335 GGAATAGGAGCTGTACATGGTGG + Intergenic
964933017 3:162048603-162048625 GGCATAAAAGCTCTACATTGGGG + Intergenic
966731748 3:183157338-183157360 GGCATAAAAGTTCTACGTGCAGG - Intronic
970092604 4:12427203-12427225 GGTATAAAAGCTCTGCATCGGGG + Intergenic
971455165 4:26837174-26837196 GGCATAAAAGGTCTATATAATGG + Intergenic
972217056 4:36909284-36909306 GGCATGAAAGCTCTACATCGGGG - Intergenic
972784986 4:42318406-42318428 GGCACAAAAGCTCTACATCAGGG - Intergenic
974304302 4:60112080-60112102 GTAATAAAATGTCTACATGGTGG + Intergenic
975205643 4:71641899-71641921 AGCATGAAAGCTCTACATTGGGG - Intergenic
975506736 4:75146575-75146597 GGCAGAAAATCTACACATGGTGG + Intergenic
977043571 4:92042485-92042507 GGCATAAGAGCTCTACATCAGGG + Intergenic
977972378 4:103227358-103227380 AGCATAAAAGCTCCACACTGGGG - Intergenic
978314180 4:107417695-107417717 GGCATAAAAGCTCTACATCGGGG - Intergenic
979472895 4:121122396-121122418 TGCATATAAGCTTAACATGGTGG - Intergenic
980072999 4:128263573-128263595 GGCATAAAAGCTCTACATTGGGG - Intergenic
980438793 4:132814817-132814839 AGCATAAAAGCTCTACATAGGGG + Intergenic
983326004 4:166257946-166257968 GGAATAAGAGCACTACATTGAGG + Intergenic
983708439 4:170686745-170686767 GGCATAAAAGCTCTACATCGGGG - Intergenic
983897973 4:173102160-173102182 GGCATGAAAGCTCTACATCGGGG - Intergenic
987930540 5:24394908-24394930 GGCATAAAAGCTCTACATTGGGG + Intergenic
989096045 5:37782162-37782184 GGCATAAAAGCTCTACACTGGGG + Intergenic
991306079 5:65177547-65177569 AGCATAAAAGCTCTACATTGGGG - Intronic
993373037 5:87115878-87115900 TGCATAAAAGCTAGGCATGGTGG - Intergenic
998552484 5:143090799-143090821 ATCATAAAAGCTTTACATTGGGG + Intronic
998844613 5:146295972-146295994 GACATAAAAGTACTGCATGGAGG - Intronic
998938658 5:147257227-147257249 AGCATAAAAGCTCTACGTCGGGG + Intronic
1000236825 5:159369782-159369804 GGCATAAAAGCTGTACATTGGGG - Intergenic
1001119846 5:168970953-168970975 AGCATGCAAGCTCTTCATGGAGG - Intronic
1001558440 5:172652583-172652605 GGCATAAAAGCTCTACATCAGGG + Intronic
1002999119 6:2314475-2314497 GGCATAAAAGCTCTACATTGGGG + Intergenic
1005461935 6:26077660-26077682 GGCATAAAAGCTCTACATCGGGG - Intergenic
1006325774 6:33352768-33352790 GGCATAAAAGCTCTACATTGGGG + Intergenic
1008123472 6:47644089-47644111 AGCATAAAAGCTCTACATTGTGG - Intergenic
1009450837 6:63798842-63798864 AGCATAGAAGATCTACATGCTGG + Intronic
1009635769 6:66262617-66262639 GGCATAAAAGCTCTACATGGGGG - Intergenic
1010384878 6:75268583-75268605 GGCATAAAAGCTCTGCATTCAGG + Intronic
1011551815 6:88537270-88537292 GGCATCAAAGCTCTCCCAGGTGG + Intergenic
1013050320 6:106527673-106527695 GGCATAAAAGATCTACCTAAAGG - Intronic
1015171927 6:130263857-130263879 GGCATGAAAACTCTACATCGGGG - Intronic
1016492610 6:144624022-144624044 AGCATAAAACATCTACCTGGTGG - Intronic
1018169766 6:161135575-161135597 TGCAGACAAGCTCTACATGCTGG + Exonic
1019339597 7:502644-502666 GGCACAAAACCACAACATGGGGG + Intronic
1019340524 7:506904-506926 GGCATAAAAACTGGAAATGGGGG + Intronic
1020043891 7:5025256-5025278 GGCATGAAAACTCTACATCGGGG + Intronic
1020655786 7:10926815-10926837 AGCATAAAAGCTCTACATCGGGG - Intergenic
1020745430 7:12073181-12073203 AGCATAAAAGCTCTGTATCGGGG - Intergenic
1021849357 7:24792328-24792350 GGCATAAAAGCTGTATATTGGGG + Intergenic
1023436341 7:40144065-40144087 GGCATAAAAGCTCTACACTGGGG + Intronic
1023799108 7:43818072-43818094 GGCGTAAAAGCTCTACATTGGGG - Intergenic
1024812947 7:53234992-53235014 GACATAAAAGCTCTACATCGTGG - Intergenic
1026246500 7:68624905-68624927 GGCATAAAAGGATAACATGGAGG - Intergenic
1028333984 7:89628777-89628799 GGCATAAAAGCTCTAGATTGGGG - Intergenic
1029486095 7:100842509-100842531 GGCATGAAAGCTCTACGTCGGGG - Intronic
1029822069 7:103156170-103156192 GGCATGAAAGCTCTACGTCGGGG - Intergenic
1030698113 7:112608221-112608243 GGGAAAACGGCTCTACATGGGGG + Intergenic
1032170555 7:129581143-129581165 GGCATAAAAACTCTACATCAGGG - Intergenic
1033097539 7:138443874-138443896 GGCATAAAAGCTCTACATCGGGG + Intergenic
1034997076 7:155584331-155584353 GGCATAAAAGCCCTGCACGAGGG + Intergenic
1038089666 8:24239231-24239253 GGCATAAAAGCTCTACATCAGGG - Intergenic
1039551911 8:38449817-38449839 GGCACAAATGCTTTACATGAAGG + Intronic
1040993399 8:53376167-53376189 GGCATGAAAGCTCTACATTGGGG + Intergenic
1041227136 8:55711953-55711975 GGCATAAAAGCTCTACATTGGGG - Intronic
1041515467 8:58694764-58694786 GGTATGAAAGCTCTACATCGGGG - Intergenic
1042087874 8:65128452-65128474 GGCATAAAAGCTCTACATCAGGG + Intergenic
1043045351 8:75315902-75315924 GGCATAAAAGCTGAACAAAGGGG + Intergenic
1044184586 8:89236408-89236430 GGCATAAAAGCTCTACATCAGGG + Intergenic
1045364413 8:101462337-101462359 GGAATAAAAGCTGGGCATGGTGG + Intergenic
1048216260 8:132498354-132498376 GTCAGAAAAGGTCTTCATGGAGG - Intergenic
1051418179 9:16864622-16864644 GGGATAAATGCACAACATGGGGG - Intronic
1053110740 9:35457599-35457621 GGCATAAAAGCTCTACATCGGGG + Intergenic
1053620617 9:39810505-39810527 TGCATAGAAGCTGGACATGGTGG + Intergenic
1053626090 9:39873429-39873451 TGCATAGAAGCTGGACATGGTGG - Intergenic
1053878784 9:42569792-42569814 TGCATAGAAGCTGGACATGGTGG + Intergenic
1053893887 9:42724579-42724601 TGCATAGAAGCTGGACATGGTGG - Intergenic
1054217798 9:62377272-62377294 TGCATAGAAGCTGGACATGGTGG + Intergenic
1054232905 9:62531903-62531925 TGCATAGAAGCTGGACATGGTGG - Intergenic
1054263544 9:62896938-62896960 TGCATAGAAGCTGGACATGGTGG - Intergenic
1056414421 9:86362526-86362548 GGCATAAAAGCTCTACATCGGGG + Intergenic
1058407563 9:104693610-104693632 GGAAAAAAAGCTGTACATGCTGG + Intergenic
1058725977 9:107804531-107804553 GGCAAAAAAAATGTACATGGAGG + Intergenic
1059794982 9:117684415-117684437 GGCATCACATTTCTACATGGGGG - Intergenic
1187935762 X:24334431-24334453 GGCATGAAAGCTCTGCATTCGGG - Intergenic
1189034567 X:37482582-37482604 GGCATAAAAGCTCTACAACAGGG - Intronic
1189833870 X:45001417-45001439 AGCATAAAAGCTCTGCATTGGGG + Intronic
1190270266 X:48857711-48857733 AGCATAAAAGCTCTACATTGGGG - Intergenic
1190771217 X:53516361-53516383 GGCATAAAAGCTCTACACTGGGG - Intergenic
1190912486 X:54786099-54786121 GGCATAAAAGGGCCACGTGGGGG - Intronic
1191639236 X:63412627-63412649 GGCATGAAAGCTCTACATCGGGG - Intergenic
1191917978 X:66222634-66222656 GGCATAAAAGCTCTACATTTGGG + Intronic
1193589095 X:83365528-83365550 GGCACAAAAACTCTGTATGGAGG - Intergenic
1193717331 X:84948374-84948396 GGCATAAAAGCTCTACATTGGGG - Intergenic
1194424846 X:93723598-93723620 AGCATAAAAATTCTACATTGAGG + Intergenic
1196422998 X:115541751-115541773 GGCATGAAAGCTGTACATTGGGG + Intergenic
1196460068 X:115920457-115920479 GGCATAAAAGCTCTACATAGGGG - Intergenic
1196869410 X:120098684-120098706 GGCATAAAAGCTCCACATCGGGG - Intergenic
1197826286 X:130593932-130593954 GGCATGAAAGGTCTACATGGAGG - Intergenic
1199232000 X:145446657-145446679 GACAGAAAAGCTCTATGTGGAGG + Intergenic
1199638353 X:149835159-149835181 TGCATAAAAGCTGTACATCAGGG - Intergenic
1200763266 Y:7059066-7059088 GGCATAAAAGCTCTACATGGGGG + Intronic
1200769240 Y:7108361-7108383 GGCATAAAAGCTCTACATGGGGG - Intergenic
1200811082 Y:7485954-7485976 GGCATAAAAGCAGAAAATGGTGG - Intergenic
1201260074 Y:12150160-12150182 AGCATAAAAGCTCTACAGTGGGG + Intergenic
1201308906 Y:12576826-12576848 GGCAAAAAAGCTCTAAATTTGGG - Intergenic