ID: 1009635770

View in Genome Browser
Species Human (GRCh38)
Location 6:66262618-66262640
Sequence TGGCATAAAAGCTCTACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 3, 1: 24, 2: 46, 3: 39, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009635770_1009635775 -1 Left 1009635770 6:66262618-66262640 CCCCATGTAGAGCTTTTATGCCA 0: 3
1: 24
2: 46
3: 39
4: 125
Right 1009635775 6:66262640-66262662 ATAGTTGGTCCAACATTCTGTGG No data
1009635770_1009635777 16 Left 1009635770 6:66262618-66262640 CCCCATGTAGAGCTTTTATGCCA 0: 3
1: 24
2: 46
3: 39
4: 125
Right 1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG No data
1009635770_1009635778 20 Left 1009635770 6:66262618-66262640 CCCCATGTAGAGCTTTTATGCCA 0: 3
1: 24
2: 46
3: 39
4: 125
Right 1009635778 6:66262661-66262683 GGACCACTAACGAGCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009635770 Original CRISPR TGGCATAAAAGCTCTACATG GGG (reversed) Intergenic
900890316 1:5444783-5444805 TGGCACAAAATTTCTACGTGTGG - Intergenic
901946335 1:12707021-12707043 CAGCATAAAAGCTCCACATTGGG + Intergenic
902051984 1:13570989-13571011 CGGCATAAAAGCTTTACATCGGG - Intergenic
904357682 1:29951602-29951624 TGGCATATAAGCCCTAGATCTGG + Intergenic
905061153 1:35140176-35140198 TGGCATGAAAGCTCTACATCGGG + Intergenic
910852954 1:91666530-91666552 TGGCATGAAAGCTCTACATCAGG + Intergenic
911858168 1:102909064-102909086 TGGAATAAAATTTCAACATGAGG - Intronic
912816025 1:112829320-112829342 CGGCATAAAAGCTCTAAATTGGG - Intergenic
912980413 1:114366036-114366058 CGGCATAAAAGCTCTACATCAGG + Intergenic
913698333 1:121349498-121349520 ACGTATAAAAGCTCTATATGGGG - Intronic
914139219 1:144930544-144930566 ACGTATAAAAGCTCTATATGGGG + Intronic
917311758 1:173686017-173686039 CAGCATAAAAGCTCTACATCAGG + Intergenic
917444325 1:175094179-175094201 AGGCATACAAGGTCTACGTGTGG + Exonic
918398881 1:184144096-184144118 TGGCATACAACCTCTTTATGGGG + Intergenic
920485732 1:206368154-206368176 ACGTATAAAAGCTCTATATGGGG - Intronic
922680768 1:227593461-227593483 TGGCATGAAAGCTCTACATTGGG + Intronic
922690157 1:227682643-227682665 TGGCATGAAAGCTCTACATCGGG - Intergenic
923342173 1:233017229-233017251 AGGCATGAAATCCCTACATGTGG + Intronic
924441106 1:244086254-244086276 TGGAATAACAGCTCTCCCTGGGG + Intergenic
924859070 1:247902405-247902427 TGGCAGGGAAGCTCTACATCGGG + Intergenic
1065931008 10:30479110-30479132 CGGCATAAAAGCTCTACATTGGG - Intergenic
1068645751 10:59465202-59465224 TGGCAAAAAAGCTCTCCAAATGG - Intergenic
1068671795 10:59730551-59730573 TGGCATGAAAGTTCTACATCGGG + Intronic
1069939249 10:71943121-71943143 TGGCATAAAAGCTCTACATCAGG - Intergenic
1071249684 10:83804245-83804267 TGGCATTAAAGCCCCACTTGGGG + Intergenic
1071283127 10:84120757-84120779 TGGCATAAAAGCACTACATCAGG + Intergenic
1072334803 10:94388514-94388536 CAGCATAAAAGCTCTACACTGGG - Intergenic
1083082197 11:60105446-60105468 TGGCATAAAAGCTCTACATCGGG + Intergenic
1083089894 11:60189098-60189120 TGGCATAAAAGTTCTACATTGGG - Intergenic
1085239784 11:75043721-75043743 CAGCATAAAAGCTCTACATTGGG - Intergenic
1086973461 11:93107591-93107613 CGGCATAAAAGCTCTACATCGGG + Intergenic
1087684516 11:101248207-101248229 TGGCATGAAAGCTCTACATTGGG - Intergenic
1087894811 11:103575703-103575725 TGGCATAAAAGCTCTACATCGGG - Intergenic
1089005011 11:115083920-115083942 TGGCAGAAGGGCTCTAGATGTGG + Intergenic
1090545875 11:127767268-127767290 TGGAATAAAATTTCTAAATGAGG + Intergenic
1090625024 11:128599701-128599723 TGGAATAAAAACTCTTAATGAGG + Intergenic
1091814515 12:3426427-3426449 TGGCATAAAAGCTCTACATCTGG + Intronic
1093356747 12:18176335-18176357 TGGCATAAAAGCTCTACATTGGG - Intronic
1093594111 12:20941120-20941142 TGGCATAAATGCTCTACAATGGG + Intergenic
1095183664 12:39176120-39176142 TGGTCAAAAAGCTCTACATAGGG + Intergenic
1095790811 12:46165086-46165108 TGAAATATAAGCTCTACAAGGGG - Intergenic
1097322920 12:58245841-58245863 GGGCAGAAAAGCTCAACATTTGG - Intergenic
1098248394 12:68543879-68543901 TGGCATAAAAGCTCTACACTGGG - Intergenic
1100803996 12:98262093-98262115 TGGCAGAAAAGCTAAAGATGTGG - Intergenic
1102606386 12:114070936-114070958 CGGCATAAAAGCTCTACATCAGG - Intergenic
1103717824 12:122956029-122956051 TGTCATAAAAGCTATAACTGAGG + Intronic
1104031795 12:125070058-125070080 TGGAATGCAAGCTCTACAGGGGG + Intronic
1105569469 13:21588062-21588084 TGGCATAAAAGCTCTACATCGGG - Intronic
1106290116 13:28353127-28353149 AGGCACAAAAGGACTACATGAGG - Intronic
1109639599 13:65172620-65172642 TTGCAGAAAAGCTCAAAATGTGG - Intergenic
1109909495 13:68890967-68890989 CAGCATAAAAGCTCTACTTCGGG + Intergenic
1110653708 13:77972504-77972526 TGGCATAAAAGCTCTATGTTGGG + Intergenic
1110770637 13:79340094-79340116 TGGCATAAAATCGCTACAATGGG + Intronic
1112727746 13:102324516-102324538 TAGCATTAAAGCTCCACAAGGGG - Intronic
1114236086 14:20824918-20824940 CGGCATAAAAGCTCTACATCGGG + Intergenic
1115211366 14:30970326-30970348 CGGCATAAAAGCTCTACATCGGG - Intronic
1117179541 14:53177957-53177979 TGGCATAAAAGCTGTACATCTGG + Intergenic
1117955196 14:61117442-61117464 TGGCATGAAAGCTCTACACTGGG + Intergenic
1118356670 14:65019656-65019678 TGCCTTAAAAGCTTTACCTGTGG + Intronic
1121528355 14:94635131-94635153 TGGGGTAAAATCTCAACATGAGG - Intergenic
1124718073 15:32085283-32085305 TGGGATAAAGGGCCTACATGGGG - Intronic
1126968903 15:54087624-54087646 TGGCATAGGAGATCTACCTGTGG - Intronic
1127673882 15:61222117-61222139 TGGTATAGAAGCTCTACCTGGGG + Intronic
1128733260 15:70034905-70034927 TGGGAAACAAGCTCTACTTGTGG - Intergenic
1130004772 15:80084521-80084543 TGGCATAAAAGGGTTAGATGAGG + Intronic
1130676019 15:85952785-85952807 TGGAATGGAACCTCTACATGGGG - Intergenic
1131681466 15:94728286-94728308 TGGCAGAAAAGCTCCACATTTGG + Intergenic
1137041602 16:35617688-35617710 CAGCATAAAAGCTCTACATCTGG + Intergenic
1138949063 16:61888365-61888387 TGGGAAAAAAGCTGGACATGAGG - Intronic
1143858706 17:9872274-9872296 TGGAATAAAAGGTGGACATGAGG + Intronic
1144530257 17:16031672-16031694 TGTCATAAAATCTGTACATTAGG - Exonic
1147810306 17:43164278-43164300 CGGCATAAAAACTCTACATCAGG + Intergenic
1148828964 17:50416790-50416812 CGGCATAAAAGCTCTACATTGGG + Intergenic
1152454947 17:80409417-80409439 CGGCATAAAAGCTCTACATTGGG - Intergenic
1153826378 18:8878774-8878796 TGGCATAAAAGCACTACATCCGG + Intergenic
1153830385 18:8917318-8917340 TGGCATAAAAGCTCTACATTGGG - Intergenic
1154014132 18:10601478-10601500 AGGCATTAAAGCTCTACATTGGG + Intergenic
1162267808 19:9590169-9590191 CGGCATAAAAGCTCTACATCGGG + Intergenic
1162561492 19:11420434-11420456 AGGCATAAAACCACTACATCGGG + Intergenic
1163867089 19:19782567-19782589 CAGCATAAAAGCTCTACGTTGGG + Intergenic
1163991850 19:21006297-21006319 TGGCATAAAAGCTCTACATTGGG - Intergenic
1164121568 19:22269935-22269957 TGGCATAAAAGCTCTACATTGGG + Intergenic
1164130722 19:22358866-22358888 TGGCATAAAAGCTCTACATTGGG + Intergenic
1165045662 19:33103006-33103028 TGGCCTAAGAGCTTCACATGTGG - Intronic
1165722496 19:38089589-38089611 TGGCATAACAGCAGTACCTGTGG - Intronic
1166582536 19:43915122-43915144 GAGCAGAAAAGCTCTTCATGAGG + Exonic
1167680325 19:50916312-50916334 TGGCATAACAGCTCAAGATATGG - Intergenic
925668492 2:6287642-6287664 TGGCTTAAAAGCTTTACTTCAGG + Intergenic
926998640 2:18768763-18768785 TAGGATAAAAGTTCTACATCAGG - Intergenic
927906409 2:26861647-26861669 TGAAATGAATGCTCTACATGAGG - Intronic
930127782 2:47816131-47816153 GGGCAGAAAAGCTCAACATTTGG + Intronic
933389464 2:81652075-81652097 TGGCATAAAAGCTCTACATCGGG + Intergenic
933785895 2:85841276-85841298 TGGCTTAGCAGCTCTACATAGGG - Intronic
935048416 2:99502583-99502605 GGGCATAAAAGCTCTATATCGGG - Intergenic
935970585 2:108527377-108527399 TGGCATGAAAGGTCTACATGGGG - Intergenic
936419597 2:112350513-112350535 TGGCATGAAAGGTCTACATGGGG + Intergenic
937706983 2:124932253-124932275 GGTCCTAAAAGCTATACATGGGG + Intergenic
939941109 2:148352487-148352509 TGGTATAAAAGAGCAACATGAGG - Intronic
943101571 2:183493135-183493157 TGGAATAAATGCTCTACTTCTGG - Intergenic
943408091 2:187514040-187514062 TGGCATAAAAGCTCTACATCGGG - Intronic
944431215 2:199635646-199635668 TGGAATAAAAATTTTACATGTGG - Intergenic
945720287 2:213410477-213410499 CAGCATAAAAGCTCTACATCGGG - Intronic
945900287 2:215529737-215529759 TGGCATAAAAGATTAACAAGTGG + Intergenic
946934939 2:224710340-224710362 TGGCATAAAAGATATCCATTTGG + Intergenic
1169571329 20:6909293-6909315 TGGTATAAAAGCTAAACAAGAGG - Intergenic
1169678442 20:8181510-8181532 TGGCTTATAAGCTCTACCTCTGG - Intronic
1175513872 20:59555655-59555677 TGGCATGAAAGCTCTACATCGGG + Intergenic
1177323039 21:19546535-19546557 TGACATAATAGCTCTAAATTAGG - Intergenic
1179670882 21:42946833-42946855 TGGCATGAAAGCTCTACGTCAGG + Intergenic
1181471759 22:23145116-23145138 TGGCATAAGAGCTCCTGATGTGG - Intergenic
1182724746 22:32435622-32435644 TGGCATAAAAGTTCTACAATAGG + Intronic
1183662496 22:39229903-39229925 TGGCCTGAGAGCCCTACATGAGG - Intronic
949610944 3:5702833-5702855 CAGCATAAAAGCTCTACATTAGG + Intergenic
950594291 3:13965235-13965257 TGGCATAAAAGCTCTGGATTGGG + Intronic
950846139 3:16017758-16017780 CGGCATAAAAGCTCTACATCGGG + Intergenic
951248549 3:20368058-20368080 TAGCATGAAAGCTCTACATCGGG + Intergenic
954575615 3:51674447-51674469 TGGCCTACAAGTTCCACATGGGG + Exonic
956293212 3:67683558-67683580 TGGCAGAAGAGCTGTAAATGGGG + Intergenic
957999918 3:87737650-87737672 TGGCATGAAAGCTCTACATCGGG + Intergenic
960235806 3:115280754-115280776 TGGCCTAAAATCTCCCCATGCGG + Intergenic
960720356 3:120619188-120619210 TGGCATAAAAGCTCTACATCAGG + Intergenic
961111043 3:124283097-124283119 TGGGAACAAAGCTCCACATGAGG - Intronic
962096745 3:132300150-132300172 TGGCATGAAAGCTCTACATCGGG + Intergenic
962277069 3:134023539-134023561 TGGCATGAAAGCTCTACATCGGG - Intronic
964537427 3:157739074-157739096 TGGCATAGGAGCCCTCCATGTGG + Intergenic
964933016 3:162048602-162048624 TGGCATAAAAGCTCTACATTGGG + Intergenic
965733086 3:171792820-171792842 TGGCATAAATCCTCTTCAGGAGG + Intronic
967690806 3:192471562-192471584 AGGCACAAAAGCTCTTCAAGTGG + Intronic
967919399 3:194603241-194603263 AGACATAAAAGCTCAAAATGAGG + Intronic
968423859 4:507837-507859 TGGCACAAAAGGTCTTCAGGAGG - Intronic
970092603 4:12427202-12427224 CGGTATAAAAGCTCTGCATCGGG + Intergenic
972217057 4:36909285-36909307 TGGCATGAAAGCTCTACATCGGG - Intergenic
972584494 4:40424851-40424873 TGGCATTAAAGTTTTACATTGGG + Exonic
972784987 4:42318407-42318429 TGGCACAAAAGCTCTACATCAGG - Intergenic
975205644 4:71641900-71641922 CAGCATGAAAGCTCTACATTGGG - Intergenic
977043570 4:92042484-92042506 CGGCATAAGAGCTCTACATCAGG + Intergenic
978314181 4:107417696-107417718 TGGCATAAAAGCTCTACATCGGG - Intergenic
978690525 4:111504153-111504175 TGGCATGTAAGCCCCACATGGGG + Intergenic
978713788 4:111817299-111817321 TGGAATAATAGCTCTTGATGAGG + Intergenic
980073000 4:128263574-128263596 TGGCATAAAAGCTCTACATTGGG - Intergenic
980239974 4:130160727-130160749 TGTAATAAAAGTTATACATGAGG + Intergenic
980438792 4:132814816-132814838 CAGCATAAAAGCTCTACATAGGG + Intergenic
983708440 4:170686746-170686768 TGGCATAAAAGCTCTACATCGGG - Intergenic
983897974 4:173102161-173102183 TGGCATGAAAGCTCTACATCGGG - Intergenic
984535913 4:180975058-180975080 AGGCATAAAAGTGCTACAGGAGG + Intergenic
984749122 4:183254737-183254759 TGGCCTAAAGGATGTACATGCGG - Intronic
984853731 4:184175498-184175520 TGGCAGAAAAGCTCTTCGTCTGG + Intronic
986880389 5:12162739-12162761 TGGAGTAAAATCTCTACTTGTGG - Intergenic
987930539 5:24394907-24394929 TGGCATAAAAGCTCTACATTGGG + Intergenic
988947260 5:36217820-36217842 TGGCATAAACCCTGTACCTGTGG - Exonic
989096044 5:37782161-37782183 TGGCATAAAAGCTCTACACTGGG + Intergenic
991306080 5:65177548-65177570 CAGCATAAAAGCTCTACATTGGG - Intronic
994721797 5:103389189-103389211 TGGAATAAAATCACTACATTTGG - Intergenic
995867430 5:116706630-116706652 TGGCATGAAAGCTCTGCCTCAGG - Intergenic
996930196 5:128877019-128877041 TGGCTTAGAACCTCTACATTAGG - Intronic
998938657 5:147257226-147257248 CAGCATAAAAGCTCTACGTCGGG + Intronic
1000236826 5:159369783-159369805 TGGCATAAAAGCTGTACATTGGG - Intergenic
1000990350 5:167905495-167905517 TGGCTTAAAAACTCCACAGGAGG + Intronic
1001558439 5:172652582-172652604 CGGCATAAAAGCTCTACATCAGG + Intronic
1002999118 6:2314474-2314496 CGGCATAAAAGCTCTACATTGGG + Intergenic
1005446025 6:25924171-25924193 TGACATAAATGCCTTACATGTGG - Intronic
1005461936 6:26077661-26077683 TGGCATAAAAGCTCTACATCGGG - Intergenic
1006325773 6:33352767-33352789 CGGCATAAAAGCTCTACATTGGG + Intergenic
1006899578 6:37491210-37491232 TGGCAGAAAAGCTGCATATGAGG - Intronic
1009635770 6:66262618-66262640 TGGCATAAAAGCTCTACATGGGG - Intergenic
1010018571 6:71134159-71134181 TGCTATAAAAGATCAACATGAGG + Intergenic
1010117839 6:72336285-72336307 TTGCATAAAAACTATACTTGTGG + Intronic
1011864453 6:91806106-91806128 AAGCATAAAAGCTTTAAATGTGG - Intergenic
1012496126 6:99835463-99835485 TGGCATAAAATCCATTCATGAGG - Intergenic
1013828078 6:114239397-114239419 TTGCATAAAAGCGCCAAATGGGG + Intronic
1015171928 6:130263858-130263880 TGGCATGAAAACTCTACATCGGG - Intronic
1016289417 6:142511729-142511751 TGATATAAAATGTCTACATGCGG - Intergenic
1016341875 6:143071058-143071080 GGCCATAAAAGGGCTACATGAGG - Intronic
1018191378 6:161311871-161311893 TGGCATAAAAGCTGTACATTGGG + Intergenic
1020043890 7:5025255-5025277 TGGCATGAAAACTCTACATCGGG + Intronic
1020148752 7:5665519-5665541 TGGAATAGAAGCTTTATATGTGG + Intronic
1020655787 7:10926816-10926838 CAGCATAAAAGCTCTACATCGGG - Intergenic
1020971322 7:14944174-14944196 TGGCAAAAATGCTCTGCAGGTGG + Intronic
1021849356 7:24792327-24792349 TGGCATAAAAGCTGTATATTGGG + Intergenic
1022651743 7:32283734-32283756 TGGCAGCAAAGCTCTGCATTGGG - Intronic
1023436340 7:40144064-40144086 CGGCATAAAAGCTCTACACTGGG + Intronic
1023665123 7:42514856-42514878 TGCTAGAAAAGCTCTGCATGTGG - Intergenic
1023799109 7:43818073-43818095 TGGCGTAAAAGCTCTACATTGGG - Intergenic
1026396295 7:69957858-69957880 TGGCATAGCAGCTCTACACTAGG + Intronic
1028333985 7:89628778-89628800 TGGCATAAAAGCTCTAGATTGGG - Intergenic
1028481383 7:91309649-91309671 TAGAATAAAAGTTCTAGATGTGG + Intergenic
1029486096 7:100842510-100842532 TGGCATGAAAGCTCTACGTCGGG - Intronic
1029822070 7:103156171-103156193 TGGCATGAAAGCTCTACGTCGGG - Intergenic
1030698112 7:112608220-112608242 TGGGAAAACGGCTCTACATGGGG + Intergenic
1031692895 7:124812794-124812816 TGAAACAAAAGCTTTACATGTGG - Intergenic
1031832078 7:126639973-126639995 TGAAATAAAAGCACTCCATGTGG + Intronic
1032170556 7:129581144-129581166 TGGCATAAAAACTCTACATCAGG - Intergenic
1033097538 7:138443873-138443895 CGGCATAAAAGCTCTACATCGGG + Intergenic
1033485146 7:141781544-141781566 TGAAATAAAACCTGTACATGTGG + Intronic
1034997075 7:155584330-155584352 TGGCATAAAAGCCCTGCACGAGG + Intergenic
1035598250 8:878662-878684 TGGCATTTAATCTCTCCATGAGG - Intergenic
1035969409 8:4230513-4230535 TGGCCTAAAAACTCTGTATGTGG - Intronic
1038089667 8:24239232-24239254 TGGCATAAAAGCTCTACATCAGG - Intergenic
1038762469 8:30397045-30397067 TGACATAAATGCTATAAATGAGG - Intronic
1040993398 8:53376166-53376188 TGGCATGAAAGCTCTACATTGGG + Intergenic
1041227137 8:55711954-55711976 CGGCATAAAAGCTCTACATTGGG - Intronic
1041515468 8:58694765-58694787 TGGTATGAAAGCTCTACATCGGG - Intergenic
1042087873 8:65128451-65128473 TGGCATAAAAGCTCTACATCAGG + Intergenic
1042553734 8:70016613-70016635 TAACATAAAAGCTCTATCTGAGG - Intergenic
1042701681 8:71622268-71622290 TGGCATCAATTCTCTTCATGTGG + Intergenic
1043752007 8:83949454-83949476 TGCCATAATATCTCTACAGGAGG + Intergenic
1044184585 8:89236407-89236429 TGGCATAAAAGCTCTACATCAGG + Intergenic
1050013904 9:1212660-1212682 TGCCATAAAATATCAACATGAGG - Intergenic
1051428708 9:16960528-16960550 TGGCAGAAAACCCCAACATGAGG + Intergenic
1053110739 9:35457598-35457620 CGGCATAAAAGCTCTACATCGGG + Intergenic
1055108355 9:72535975-72535997 TGGGATAAAATTTCAACATGAGG + Intronic
1055666243 9:78555875-78555897 TGCCATAAAGGAGCTACATGTGG + Intergenic
1056320200 9:85428675-85428697 TGGCAAAATAGCACTACACGGGG - Intergenic
1056414420 9:86362525-86362547 CGGCATAAAAGCTCTACATCGGG + Intergenic
1059973324 9:119689988-119690010 AGGAATAAAAGCTGTAGATGGGG + Intergenic
1185779693 X:2833462-2833484 TGGCTTTATAGCTCTTCATGGGG - Intronic
1187935763 X:24334432-24334454 GGGCATGAAAGCTCTGCATTCGG - Intergenic
1189015051 X:37088284-37088306 TGACATAAATGCTATAAATGAGG - Intergenic
1189034568 X:37482583-37482605 CGGCATAAAAGCTCTACAACAGG - Intronic
1189833869 X:45001416-45001438 CAGCATAAAAGCTCTGCATTGGG + Intronic
1190270267 X:48857712-48857734 CAGCATAAAAGCTCTACATTGGG - Intergenic
1190771218 X:53516362-53516384 TGGCATAAAAGCTCTACACTGGG - Intergenic
1191639237 X:63412628-63412650 CGGCATGAAAGCTCTACATCGGG - Intergenic
1191917977 X:66222633-66222655 TGGCATAAAAGCTCTACATTTGG + Intronic
1193520867 X:82527910-82527932 TTGAATAGAAGCACTACATGTGG - Intergenic
1193717332 X:84948375-84948397 TGGCATAAAAGCTCTACATTGGG - Intergenic
1195846849 X:109238130-109238152 TTGCATAAAAGCTCTACATCGGG + Intergenic
1196422997 X:115541750-115541772 TGGCATGAAAGCTGTACATTGGG + Intergenic
1196460069 X:115920458-115920480 CGGCATAAAAGCTCTACATAGGG - Intergenic
1196869411 X:120098685-120098707 CGGCATAAAAGCTCCACATCGGG - Intergenic
1199009211 X:142739295-142739317 TGGCATAAATGTTCTCCATTTGG + Intergenic
1199638354 X:149835160-149835182 CTGCATAAAAGCTGTACATCAGG - Intergenic
1200763265 Y:7059065-7059087 TGGCATAAAAGCTCTACATGGGG + Intronic
1200769241 Y:7108362-7108384 TGGCATAAAAGCTCTACATGGGG - Intergenic
1201260073 Y:12150159-12150181 TAGCATAAAAGCTCTACAGTGGG + Intergenic
1201290345 Y:12416529-12416551 TGGCTTTATAGCTCTTCATGGGG + Intergenic
1201308907 Y:12576827-12576849 TGGCAAAAAAGCTCTAAATTTGG - Intergenic