ID: 1009635771

View in Genome Browser
Species Human (GRCh38)
Location 6:66262619-66262641
Sequence ATGGCATAAAAGCTCTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 20, 1: 35, 2: 31, 3: 19, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009635771_1009635778 19 Left 1009635771 6:66262619-66262641 CCCATGTAGAGCTTTTATGCCAT 0: 20
1: 35
2: 31
3: 19
4: 135
Right 1009635778 6:66262661-66262683 GGACCACTAACGAGCAAGGATGG No data
1009635771_1009635775 -2 Left 1009635771 6:66262619-66262641 CCCATGTAGAGCTTTTATGCCAT 0: 20
1: 35
2: 31
3: 19
4: 135
Right 1009635775 6:66262640-66262662 ATAGTTGGTCCAACATTCTGTGG No data
1009635771_1009635777 15 Left 1009635771 6:66262619-66262641 CCCATGTAGAGCTTTTATGCCAT 0: 20
1: 35
2: 31
3: 19
4: 135
Right 1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009635771 Original CRISPR ATGGCATAAAAGCTCTACAT GGG (reversed) Intergenic
900762121 1:4480249-4480271 GTGGCACACAAGCTCTACACTGG - Intergenic
901946334 1:12707020-12707042 ACAGCATAAAAGCTCCACATTGG + Intergenic
902051985 1:13570990-13571012 ACGGCATAAAAGCTTTACATCGG - Intergenic
904759172 1:32789124-32789146 ATGGCATAAAAACTATAAGTAGG - Intronic
905061152 1:35140175-35140197 ATGGCATGAAAGCTCTACATCGG + Intergenic
905591830 1:39170729-39170751 ATAGAATATAAGCTCTACAAGGG - Intronic
906754969 1:48303019-48303041 ATGGCACAAAAGTTCTACTAGGG - Intronic
907642486 1:56205161-56205183 ATGGTATAAGAGCTGTACAATGG + Intergenic
910186416 1:84545937-84545959 ATAGAATAAATGCTTTACATAGG + Intergenic
911135422 1:94433988-94434010 ATGGCATAAAAGATCAAAAACGG + Intronic
912816026 1:112829321-112829343 ACGGCATAAAAGCTCTAAATTGG - Intergenic
918284593 1:183039694-183039716 AGGACATAAAAGCTCTAAAGTGG - Intronic
919023550 1:192139389-192139411 ATAGAATAAAATCTCTTCATGGG - Intergenic
919105587 1:193146669-193146691 ATGGAATAAAATTTCAACATGGG + Intronic
919352090 1:196470579-196470601 AGGCCACAAAAGCTTTACATGGG + Intronic
922579835 1:226688667-226688689 CTAGCATAAAAGCTCTGCCTGGG - Intronic
922633540 1:227140234-227140256 CTGGAATATAAGCTCTATATGGG - Intronic
922680767 1:227593460-227593482 ATGGCATGAAAGCTCTACATTGG + Intronic
922690158 1:227682644-227682666 ATGGCATGAAAGCTCTACATCGG - Intergenic
924441105 1:244086253-244086275 ATGGAATAACAGCTCTCCCTGGG + Intergenic
924859069 1:247902404-247902426 ATGGCAGGGAAGCTCTACATCGG + Intergenic
924880378 1:248155310-248155332 ATAGCATAAAACCTCAACATTGG + Intergenic
1065931009 10:30479111-30479133 ACGGCATAAAAGCTCTACATTGG - Intergenic
1066334757 10:34464266-34464288 ATAGCTTAAAGGTTCTACATGGG - Intronic
1068671794 10:59730550-59730572 ATGGCATGAAAGTTCTACATCGG + Intronic
1069071161 10:63991795-63991817 ATGGAATATAAGCTCTATAAAGG - Intergenic
1070677215 10:78420426-78420448 CTGGAATATAAGCTCTACAAGGG - Intergenic
1072334804 10:94388515-94388537 ACAGCATAAAAGCTCTACACTGG - Intergenic
1072477101 10:95772958-95772980 ATGGCTTGAAAGCTCAAGATTGG + Intronic
1074699535 10:116080981-116081003 AAGGCAGAGAAGCTCTCCATTGG + Intronic
1080204181 11:29710255-29710277 CTGGGATAAAAGCTCTGCAAGGG - Intergenic
1083082196 11:60105445-60105467 ATGGCATAAAAGCTCTACATCGG + Intergenic
1083089895 11:60189099-60189121 ATGGCATAAAAGTTCTACATTGG - Intergenic
1085239785 11:75043722-75043744 ACAGCATAAAAGCTCTACATTGG - Intergenic
1086973460 11:93107590-93107612 ACGGCATAAAAGCTCTACATCGG + Intergenic
1087215481 11:95488562-95488584 AGGTCATAAGAGCTCTGCATAGG + Intergenic
1087684517 11:101248208-101248230 ATGGCATGAAAGCTCTACATTGG - Intergenic
1087894812 11:103575704-103575726 ATGGCATAAAAGCTCTACATCGG - Intergenic
1092099439 12:5871063-5871085 TTGGCATAAAGGCACCACATGGG + Intronic
1093356748 12:18176336-18176358 ATGGCATAAAAGCTCTACATTGG - Intronic
1093594110 12:20941119-20941141 ATGGCATAAATGCTCTACAATGG + Intergenic
1093637109 12:21483844-21483866 ATAGAATAAATGCTCTTCATTGG - Intronic
1095183663 12:39176119-39176141 CTGGTCAAAAAGCTCTACATAGG + Intergenic
1095462266 12:42455597-42455619 ATTGCATCTAATCTCTACATGGG - Intronic
1095686990 12:45047975-45047997 ATGGAATGTAAGCTCTACAAGGG + Intronic
1098121955 12:67250479-67250501 ATGGCATAAAAGCTACAGAATGG + Intergenic
1098248395 12:68543880-68543902 ATGGCATAAAAGCTCTACACTGG - Intergenic
1101091876 12:101295354-101295376 ATGGCATTAGACCTCTACATAGG - Intronic
1103153720 12:118664766-118664788 ATGGCATCCAAGCTCTACAGTGG - Intergenic
1104031794 12:125070057-125070079 ATGGAATGCAAGCTCTACAGGGG + Intronic
1104187417 12:126446053-126446075 ATGCCATAAAAGATCCCCATGGG + Intergenic
1105569470 13:21588063-21588085 ATGGCATAAAAGCTCTACATCGG - Intronic
1105792609 13:23817237-23817259 AAGGCAGAAAAGCTTTACAAAGG + Intronic
1106289310 13:28345987-28346009 ATGACATAAAAGGGCTACTTTGG + Intronic
1108006909 13:45957649-45957671 ATGGAATAAAAGCTCTTCTATGG + Intronic
1109909494 13:68890966-68890988 ACAGCATAAAAGCTCTACTTCGG + Intergenic
1110653707 13:77972503-77972525 ATGGCATAAAAGCTCTATGTTGG + Intergenic
1110770636 13:79340093-79340115 CTGGCATAAAATCGCTACAATGG + Intronic
1114236085 14:20824917-20824939 ACGGCATAAAAGCTCTACATCGG + Intergenic
1114261612 14:21040930-21040952 ATGGAATGTAAGCTCTACAAAGG + Intronic
1115211367 14:30970327-30970349 ACGGCATAAAAGCTCTACATCGG - Intronic
1117352803 14:54897825-54897847 ATGGGTTAAAAGCTTTACGTTGG - Intronic
1117955195 14:61117441-61117463 ATGGCATGAAAGCTCTACACTGG + Intergenic
1118557420 14:67041154-67041176 AAGGCATCATAGCTCTACTTTGG + Intronic
1118960816 14:70529662-70529684 ATGGCATAAAAGATATAAAATGG + Intronic
1120206568 14:81593260-81593282 ATGCCATAAACGCACTACAATGG - Intergenic
1125378183 15:39056479-39056501 ATGACATAAAAGCTTTGGATTGG + Intergenic
1126184082 15:45813837-45813859 AAGGCATAAAAATTATACATTGG - Intergenic
1126985308 15:54299931-54299953 ATGTCATAATAGCTCTGGATAGG - Intronic
1127626413 15:60784460-60784482 ATGGAATCAAAGCTCTATAATGG - Intronic
1127673881 15:61222116-61222138 ATGGTATAGAAGCTCTACCTGGG + Intronic
1130374287 15:83314382-83314404 TTGTCATAAAAGCTGTATATGGG - Intergenic
1136043071 16:27595674-27595696 CTGGCACATAAGCTCTACAGGGG - Intronic
1137749927 16:50853551-50853573 AGGGGATGAAAGCTCTACCTAGG + Intergenic
1146495772 17:33320666-33320688 ATGGCTTAAGAGTTCCACATAGG - Intronic
1147746068 17:42695452-42695474 ATGACATAAAACCTCTGAATTGG + Intronic
1147783111 17:42958099-42958121 ATGGCATACAAGCTGTATCTGGG - Intronic
1148828963 17:50416789-50416811 ACGGCATAAAAGCTCTACATTGG + Intergenic
1150413828 17:64970737-64970759 ATGACATGAAAGATTTACATAGG - Intergenic
1150797812 17:68252965-68252987 ATGACATAAAAGATTTACATAGG + Intronic
1152454948 17:80409418-80409440 ACGGCATAAAAGCTCTACATTGG - Intergenic
1153830386 18:8917319-8917341 ATGGCATAAAAGCTCTACATTGG - Intergenic
1153834507 18:8951862-8951884 ATGGAATAAGAGCTCAACAAAGG + Intergenic
1154014131 18:10601477-10601499 AAGGCATTAAAGCTCTACATTGG + Intergenic
1156034312 18:32749732-32749754 ATTGCATAAAAGCAGTAAATGGG + Intronic
1156217473 18:35014457-35014479 ATTGTATAAAAGCTCTTCTTTGG + Intronic
1158315839 18:56210504-56210526 AGGGCATCAAAGATCTGCATGGG + Intergenic
1159067494 18:63586278-63586300 ATGGCATAAAATCTCTGAGTCGG - Intergenic
1159730593 18:72022578-72022600 AGGGTATAAAATCTCTACCTAGG + Intergenic
1161744926 19:6050767-6050789 ATGGCCAAACACCTCTACATTGG + Intronic
1162267807 19:9590168-9590190 ACGGCATAAAAGCTCTACATCGG + Intergenic
1162561491 19:11420433-11420455 CAGGCATAAAACCACTACATCGG + Intergenic
1163867088 19:19782566-19782588 ACAGCATAAAAGCTCTACGTTGG + Intergenic
1163991851 19:21006298-21006320 ATGGCATAAAAGCTCTACATTGG - Intergenic
1164121567 19:22269934-22269956 ATGGCATAAAAGCTCTACATTGG + Intergenic
1164130721 19:22358865-22358887 ATGGCATAAAAGCTCTACATTGG + Intergenic
1164216957 19:23158956-23158978 ATGGCATAAAAGTTCTACATTGG + Intergenic
1165058337 19:33193148-33193170 ATGGCAAAAATGCTCAACAGAGG - Intronic
1166829605 19:45631145-45631167 AAGGTATAAAAGCCCAACATTGG - Intronic
925021186 2:569507-569529 ATGGCATAATAGATCTTCCTAGG + Intergenic
927450383 2:23204536-23204558 ACGGCAGAAAAGCGCTACAAGGG + Intergenic
932587225 2:73038301-73038323 ATGGCATAAAAGATAAACAATGG + Intronic
933389463 2:81652074-81652096 ATGGCATAAAAGCTCTACATCGG + Intergenic
933785896 2:85841277-85841299 CTGGCTTAGCAGCTCTACATAGG - Intronic
934965542 2:98718756-98718778 ATGGAATGCAGGCTCTACATTGG + Intronic
935048417 2:99502584-99502606 AGGGCATAAAAGCTCTATATCGG - Intergenic
935480024 2:103575635-103575657 AAGGCATAAAAATTATACATTGG + Intergenic
935486781 2:103665986-103666008 ATGGAATAGAAGCTATTCATAGG - Intergenic
935970586 2:108527378-108527400 ATGGCATGAAAGGTCTACATGGG - Intergenic
936419596 2:112350512-112350534 ATGGCATGAAAGGTCTACATGGG + Intergenic
936469660 2:112787659-112787681 TTGGTATAAAAGCTCTTCAGAGG + Intergenic
937706982 2:124932252-124932274 AGGTCCTAAAAGCTATACATGGG + Intergenic
943408092 2:187514041-187514063 ATGGCATAAAAGCTCTACATCGG - Intronic
943739379 2:191394770-191394792 ATGATATAAAAGCTTTATATTGG - Intronic
945720288 2:213410478-213410500 ACAGCATAAAAGCTCTACATCGG - Intronic
947125888 2:226868015-226868037 ATGGCTTAAAAGCATTAGATCGG - Intronic
1170881580 20:20301205-20301227 ATGGCATAAAAGATTTAAAAAGG - Intronic
1175238788 20:57531100-57531122 ATGGTAAGAAAGCTCAACATGGG + Intergenic
1175513871 20:59555654-59555676 GTGGCATGAAAGCTCTACATCGG + Intergenic
949155670 3:824869-824891 GTGGCATAAAAGTTTGACATAGG + Intergenic
949621731 3:5820497-5820519 ATGACAGAACAGCTCTTCATAGG - Intergenic
950594290 3:13965234-13965256 ATGGCATAAAAGCTCTGGATTGG + Intronic
950846138 3:16017757-16017779 ACGGCATAAAAGCTCTACATCGG + Intergenic
951248548 3:20368057-20368079 ATAGCATGAAAGCTCTACATCGG + Intergenic
951809397 3:26682986-26683008 CTGGCATAAAAACTATAGATAGG - Intronic
956293211 3:67683557-67683579 ATGGCAGAAGAGCTGTAAATGGG + Intergenic
957496240 3:80994596-80994618 AAGGGATAAAATCTGTACATTGG + Intergenic
957999917 3:87737649-87737671 ATGGCATGAAAGCTCTACATCGG + Intergenic
958980653 3:100715270-100715292 ATGGCTTATAAGCTCACCATAGG + Intronic
962096744 3:132300149-132300171 ATGGCATGAAAGCTCTACATCGG + Intergenic
962277070 3:134023540-134023562 ATGGCATGAAAGCTCTACATCGG - Intronic
963981646 3:151544502-151544524 ATGGCTTAAAAATTCTAAATTGG + Intergenic
964933015 3:162048601-162048623 ATGGCATAAAAGCTCTACATTGG + Intergenic
965819834 3:172673987-172674009 CAGGCAGAAAAGCTCTAAATTGG + Intronic
967491672 3:190098863-190098885 AGGTCATACAAGCTCTTCATTGG + Intronic
970092602 4:12427201-12427223 ACGGTATAAAAGCTCTGCATCGG + Intergenic
970520322 4:16877066-16877088 TTGGAATAAAAGCTCTAGTTAGG - Intronic
971903152 4:32689521-32689543 CTGGAAAAAAAGCTCTAAATTGG + Intergenic
972217058 4:36909286-36909308 ATGGCATGAAAGCTCTACATCGG - Intergenic
972584493 4:40424850-40424872 ATGGCATTAAAGTTTTACATTGG + Exonic
973093820 4:46171967-46171989 CTGGAATATAAGTTCTACATGGG - Intergenic
975205645 4:71641901-71641923 ACAGCATGAAAGCTCTACATTGG - Intergenic
976750744 4:88449407-88449429 ATGGCAAACAAGCTCTTCACTGG + Intergenic
977972380 4:103227360-103227382 ACAGCATAAAAGCTCCACACTGG - Intergenic
978314182 4:107417697-107417719 ATGGCATAAAAGCTCTACATCGG - Intergenic
978963372 4:114711471-114711493 ATGGCATAAAAGACCTTCAATGG + Intergenic
979077061 4:116285087-116285109 AGGGCATAGAACCTCTTCATTGG + Intergenic
979910648 4:126361703-126361725 AAGGCATAGAAGATTTACATTGG - Intergenic
980073001 4:128263575-128263597 ATGGCATAAAAGCTCTACATTGG - Intergenic
980438791 4:132814815-132814837 ACAGCATAAAAGCTCTACATAGG + Intergenic
982874501 4:160628886-160628908 ATAGCATTAAATCTCTATATTGG + Intergenic
983708441 4:170686747-170686769 ATGGCATAAAAGCTCTACATCGG - Intergenic
983897975 4:173102162-173102184 ATGGCATGAAAGCTCTACATCGG - Intergenic
987930538 5:24394906-24394928 ATGGCATAAAAGCTCTACATTGG + Intergenic
988855753 5:35226832-35226854 CTGGCATAGAAGCTCCACAAGGG + Intronic
989096043 5:37782160-37782182 ATGGCATAAAAGCTCTACACTGG + Intergenic
991306081 5:65177549-65177571 ACAGCATAAAAGCTCTACATTGG - Intronic
992543959 5:77792298-77792320 ATTGCATAAAATCTATAGATCGG + Intronic
993072743 5:83186791-83186813 GTGGCATAAAAGTTCAATATAGG + Intronic
993970054 5:94408286-94408308 ATTGCACAAAAGCTCTATGTTGG - Intronic
994621529 5:102168964-102168986 ATGGCATAAAAGATAAAAATTGG - Intergenic
995511038 5:112909631-112909653 ATGGCAGAAATTCTTTACATTGG + Intronic
998552482 5:143090797-143090819 ACATCATAAAAGCTTTACATTGG + Intronic
998565990 5:143216359-143216381 ATGGCATTAAAGCCCTTCAGTGG + Intronic
998938656 5:147257225-147257247 ACAGCATAAAAGCTCTACGTCGG + Intronic
1000236827 5:159369784-159369806 ATGGCATAAAAGCTGTACATTGG - Intergenic
1001352604 5:170983946-170983968 AAAGCCTTAAAGCTCTACATTGG + Intronic
1002999117 6:2314473-2314495 ACGGCATAAAAGCTCTACATTGG + Intergenic
1003994681 6:11527541-11527563 ATGGCATAAAAGATAAAAATTGG - Intergenic
1004566697 6:16804659-16804681 ATGGTATGAAAGCTATACCTAGG - Intergenic
1005270106 6:24154562-24154584 ATGCAATAAAACCACTACATGGG + Intronic
1005461937 6:26077662-26077684 ATGGCATAAAAGCTCTACATCGG - Intergenic
1006325772 6:33352766-33352788 ACGGCATAAAAGCTCTACATTGG + Intergenic
1006596761 6:35199158-35199180 ATGGCATCAAAGCTATAAAGAGG - Intergenic
1006637341 6:35469924-35469946 ATGGCATAACCGCTGTACAACGG - Intronic
1009336870 6:62501888-62501910 ATGGCATAAAAGCATAACCTAGG - Intergenic
1009635771 6:66262619-66262641 ATGGCATAAAAGCTCTACATGGG - Intergenic
1011570387 6:88728422-88728444 ACAGCATAAAAGCTCTACATTGG - Intronic
1014245308 6:119061722-119061744 ATGAAATAAGAGCTCTACAAAGG + Intronic
1014543291 6:122701557-122701579 ATGGCATAACAGTGCCACATAGG + Intronic
1015171929 6:130263859-130263881 ATGGCATGAAAACTCTACATCGG - Intronic
1016371982 6:143384676-143384698 ATCCCATAAAAGTTCTACACAGG - Intergenic
1018191377 6:161311870-161311892 ATGGCATAAAAGCTGTACATTGG + Intergenic
1019182912 6:170203054-170203076 AAGTCTTAAAAGCTCTACCTGGG - Intergenic
1020043889 7:5025254-5025276 ATGGCATGAAAACTCTACATCGG + Intronic
1020655788 7:10926817-10926839 ACAGCATAAAAGCTCTACATCGG - Intergenic
1020745432 7:12073183-12073205 ACAGCATAAAAGCTCTGTATCGG - Intergenic
1021849355 7:24792326-24792348 ATGGCATAAAAGCTGTATATTGG + Intergenic
1022651744 7:32283735-32283757 CTGGCAGCAAAGCTCTGCATTGG - Intronic
1023051929 7:36259985-36260007 ATGGCACAAAGGAGCTACATGGG - Intronic
1023436339 7:40144063-40144085 ACGGCATAAAAGCTCTACACTGG + Intronic
1023799110 7:43818074-43818096 ATGGCGTAAAAGCTCTACATTGG - Intergenic
1023799509 7:43821728-43821750 ACGGCATAAAAGCTCCACCTCGG - Intergenic
1024124385 7:46277245-46277267 ATGGCATAACTGCACTAAATGGG - Intergenic
1026441812 7:70451568-70451590 GTGGCATAAAAAAACTACATAGG - Intronic
1026526806 7:71160791-71160813 TTGGCCTAAAAGTTCCACATAGG - Intronic
1027029616 7:74878334-74878356 ATACCTTAAAAGCTCAACATGGG - Intergenic
1028333986 7:89628779-89628801 ATGGCATAAAAGCTCTAGATTGG - Intergenic
1029026928 7:97426306-97426328 ATGGCACAAGATCTCTACATGGG + Intergenic
1029486097 7:100842511-100842533 ATGGCATGAAAGCTCTACGTCGG - Intronic
1029822071 7:103156172-103156194 ATGGCATGAAAGCTCTACGTCGG - Intergenic
1030235364 7:107254002-107254024 CTACAATAAAAGCTCTACATGGG + Intronic
1030698111 7:112608219-112608241 ATGGGAAAACGGCTCTACATGGG + Intergenic
1030825263 7:114148135-114148157 ATTACTTAAAAGATCTACATCGG - Intronic
1033097537 7:138443872-138443894 ACGGCATAAAAGCTCTACATCGG + Intergenic
1035766170 8:2107387-2107409 ATGGCATAAATGATCTCCAGGGG + Intronic
1038685535 8:29714237-29714259 AAGGCATAAAAACACCACATGGG + Intergenic
1040430083 8:47331504-47331526 ATGGCATAAAAGATAAACAGTGG + Intronic
1040993397 8:53376165-53376187 ATGGCATGAAAGCTCTACATTGG + Intergenic
1041227138 8:55711955-55711977 ACGGCATAAAAGCTCTACATTGG - Intronic
1041515469 8:58694766-58694788 ATGGTATGAAAGCTCTACATCGG - Intergenic
1042697259 8:71568626-71568648 GTGGCCTAAAAGCTCTAATTTGG - Intronic
1043045349 8:75315900-75315922 AGGGCATAAAAGCTGAACAAAGG + Intergenic
1043317855 8:78943508-78943530 ATGTGACAAAATCTCTACATTGG - Intergenic
1048538167 8:135316984-135317006 ATGGCTCAAAAGATATACATAGG - Intergenic
1051447784 9:17159511-17159533 ATGGAATATAGGCTCTACTTTGG - Intronic
1052580262 9:30346494-30346516 ATGGCATAAAAGGTCTAAGCAGG + Intergenic
1053110738 9:35457597-35457619 ACGGCATAAAAGCTCTACATCGG + Intergenic
1054783301 9:69186066-69186088 ATGTCTTAAAACCACTACATTGG - Intronic
1056414419 9:86362524-86362546 ACGGCATAAAAGCTCTACATCGG + Intergenic
1187053603 X:15718626-15718648 ATGCCAAAAAACCTCTAGATAGG - Intronic
1188835696 X:34951767-34951789 ATGGCATTAAATCTGTATATTGG - Intergenic
1189001039 X:36947185-36947207 ATGGCATAAATGTACTACATTGG - Intergenic
1189833868 X:45001415-45001437 ACAGCATAAAAGCTCTGCATTGG + Intronic
1190270268 X:48857713-48857735 ACAGCATAAAAGCTCTACATTGG - Intergenic
1190471111 X:50780562-50780584 TTGGCACAAAAGCACTATATGGG + Intronic
1190771219 X:53516363-53516385 ATGGCATAAAAGCTCTACACTGG - Intergenic
1191062252 X:56311224-56311246 AAGGCATAAAAATTATACATTGG + Intergenic
1191639238 X:63412629-63412651 ACGGCATGAAAGCTCTACATCGG - Intergenic
1193717333 X:84948376-84948398 ATGGCATAAAAGCTCTACATTGG - Intergenic
1194416087 X:93613682-93613704 TTTGCATAAAAGCTTTACACAGG - Intergenic
1195846848 X:109238129-109238151 ATTGCATAAAAGCTCTACATCGG + Intergenic
1196422996 X:115541749-115541771 ATGGCATGAAAGCTGTACATTGG + Intergenic
1196460070 X:115920459-115920481 ACGGCATAAAAGCTCTACATAGG - Intergenic
1196869412 X:120098686-120098708 ACGGCATAAAAGCTCCACATCGG - Intergenic
1198034911 X:132792271-132792293 ATGGCATCAATGCTCTTCAAGGG + Intronic
1199278620 X:145974262-145974284 ATTGCATAAAAGCTCTGCACTGG - Intergenic
1200763264 Y:7059064-7059086 ATGGCATAAAAGCTCTACATGGG + Intronic
1200769242 Y:7108363-7108385 ATGGCATAAAAGCTCTACATGGG - Intergenic
1201260072 Y:12150158-12150180 ATAGCATAAAAGCTCTACAGTGG + Intergenic