ID: 1009635772

View in Genome Browser
Species Human (GRCh38)
Location 6:66262620-66262642
Sequence TATGGCATAAAAGCTCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 3, 1: 0, 2: 3, 3: 13, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009635772_1009635777 14 Left 1009635772 6:66262620-66262642 CCATGTAGAGCTTTTATGCCATA 0: 3
1: 0
2: 3
3: 13
4: 149
Right 1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG No data
1009635772_1009635775 -3 Left 1009635772 6:66262620-66262642 CCATGTAGAGCTTTTATGCCATA 0: 3
1: 0
2: 3
3: 13
4: 149
Right 1009635775 6:66262640-66262662 ATAGTTGGTCCAACATTCTGTGG No data
1009635772_1009635778 18 Left 1009635772 6:66262620-66262642 CCATGTAGAGCTTTTATGCCATA 0: 3
1: 0
2: 3
3: 13
4: 149
Right 1009635778 6:66262661-66262683 GGACCACTAACGAGCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009635772 Original CRISPR TATGGCATAAAAGCTCTACA TGG (reversed) Intergenic
902858933 1:19230590-19230612 TGTGGAATGAAAGCTCCACAAGG + Intronic
905591831 1:39170730-39170752 GATAGAATATAAGCTCTACAAGG - Intronic
906754970 1:48303020-48303042 CATGGCACAAAAGTTCTACTAGG - Intronic
908427477 1:64021512-64021534 TGTGCCATAAAAACTCTGCAAGG + Intronic
908995181 1:70143513-70143535 TCTTCCATAAAAGCTTTACAAGG - Intronic
911672145 1:100619482-100619504 TATTGGATAAAAGCTCTGCTGGG - Intergenic
914961316 1:152211325-152211347 TATGGCATAAAAGATAAAAAAGG + Intergenic
919023551 1:192139390-192139412 TATAGAATAAAATCTCTTCATGG - Intergenic
919352089 1:196470578-196470600 TAGGCCACAAAAGCTTTACATGG + Intronic
921108895 1:212013678-212013700 TATGGCATAAAAGATAAAAATGG - Intronic
921223327 1:212991330-212991352 TATGTCAAAAAAACTGTACAAGG - Intronic
924188989 1:241529079-241529101 TAGGGGATCAAACCTCTACAGGG + Intergenic
924425523 1:243946569-243946591 TCTCGCATAAAAGCTCTTCTTGG - Intergenic
924435951 1:244042407-244042429 TATGGGACAACAGCTTTACAGGG - Intergenic
924441104 1:244086252-244086274 TATGGAATAACAGCTCTCCCTGG + Intergenic
1063835690 10:10009156-10009178 TATGGCATAGTGGCTGTACATGG + Intergenic
1064057242 10:12107759-12107781 TATAGCATAACAGTTCTAGAAGG + Intronic
1064247761 10:13682886-13682908 TCTTGCATAAAAACTCAACACGG + Intronic
1069456502 10:68558253-68558275 GATGGAATGCAAGCTCTACAAGG + Intergenic
1070677216 10:78420427-78420449 ACTGGAATATAAGCTCTACAAGG - Intergenic
1071866775 10:89743081-89743103 TTTGGCAGTAAAGCTCCACAAGG + Intronic
1074169995 10:110923145-110923167 TATTTCAAAAAAGATCTACAGGG - Intronic
1075288395 10:121207188-121207210 TATGGCATAAAATATGCACAGGG - Intergenic
1078085479 11:8230996-8231018 GATGCCATCACAGCTCTACATGG - Intronic
1080204182 11:29710256-29710278 CCTGGGATAAAAGCTCTGCAAGG - Intergenic
1091984552 12:4897967-4897989 TATGGTATAAAACCTGTATAGGG + Intergenic
1094330148 12:29282480-29282502 TATTGCTTAAAAGCTATACCAGG - Intronic
1094695599 12:32815100-32815122 TATGGCCTCCAATCTCTACAAGG + Intronic
1095686989 12:45047974-45047996 CATGGAATGTAAGCTCTACAAGG + Intronic
1099906281 12:88775207-88775229 AATATCATAAAAACTCTACAAGG - Intergenic
1104031793 12:125070056-125070078 CATGGAATGCAAGCTCTACAGGG + Intronic
1107231949 13:38120403-38120425 TATGCCATAAACCATCTACATGG - Intergenic
1108100453 13:46948614-46948636 TATGGCCTTAAGGCTATACACGG - Intergenic
1110048007 13:70855674-70855696 TAAGGTATTAAATCTCTACAGGG + Intergenic
1114750057 14:25194072-25194094 TATGGAATATAAGCTTCACAAGG - Intergenic
1115368467 14:32585112-32585134 TATGAAATAAAATCTCTAGAGGG - Intronic
1116145870 14:41068618-41068640 TATGGCAGAAATGGTCTACAAGG - Intergenic
1117646490 14:57858783-57858805 TATGGGATATAAGATCTAAAAGG + Intronic
1122534068 14:102450090-102450112 TATGTCATAAAAGGTTTCCAGGG - Intronic
1124039927 15:26092309-26092331 ATTGGAATAAAAGCTCAACAGGG - Intergenic
1125864857 15:43036773-43036795 TATGGCATGAAATCACTTCAGGG + Intronic
1127673880 15:61222115-61222137 TATGGTATAGAAGCTCTACCTGG + Intronic
1127705620 15:61544749-61544771 TGTCTCCTAAAAGCTCTACAAGG + Intergenic
1128293965 15:66501168-66501190 TATGGCTTAAGAGCTATAAAAGG + Intronic
1128882090 15:71253166-71253188 TAAGGCAGAAAAGCTTAACATGG - Intronic
1130374288 15:83314383-83314405 TTTGTCATAAAAGCTGTATATGG - Intergenic
1135964624 16:27025431-27025453 TATGGCATAAACATTGTACATGG - Intergenic
1136043072 16:27595675-27595697 GCTGGCACATAAGCTCTACAGGG - Intronic
1137500414 16:49006943-49006965 AATGGAATAAAATCTCTTCATGG + Intergenic
1138548083 16:57731198-57731220 TCTGGAGGAAAAGCTCTACAAGG + Exonic
1139690834 16:68641035-68641057 AATGGCCTACATGCTCTACAAGG + Intronic
1143307251 17:5957225-5957247 ATTCTCATAAAAGCTCTACAAGG - Intronic
1143962796 17:10734591-10734613 TTTGGCCTGTAAGCTCTACAAGG - Intergenic
1149335848 17:55635099-55635121 TGTGGAATAAAAACCCTACAAGG - Intergenic
1150054198 17:61996813-61996835 TAGAACATAAAAGCTCCACAAGG + Intronic
1150922260 17:69496057-69496079 CATGACATAAAAGGTCTACTAGG + Intronic
1151638938 17:75374846-75374868 TATGGCATATACTCTCTGCACGG + Intronic
1153150701 18:2089502-2089524 TGTGGAATACAAGCTGTACAGGG + Intergenic
1154963977 18:21338244-21338266 GAGGGAATAAGAGCTCTACATGG + Intronic
1156034311 18:32749731-32749753 TATTGCATAAAAGCAGTAAATGG + Intronic
1156332785 18:36140298-36140320 TGTGGCTAAAAAGCTATACAAGG - Intronic
1164731204 19:30506213-30506235 CCTGGCATAAAAGCTCTGGAGGG + Intronic
925029495 2:638209-638231 TATGGTATAAAAGATAAACATGG + Intergenic
927450382 2:23204535-23204557 CACGGCAGAAAAGCGCTACAAGG + Intergenic
930132187 2:47863600-47863622 TATGGCATAACAGTTTTTCAAGG + Intronic
930679975 2:54246940-54246962 GATAGGATAAAAGCTCTAAAAGG + Intronic
931680133 2:64739731-64739753 TATGGTAAAAAAGCTCTCTAAGG + Intronic
935412983 2:102785319-102785341 TATTGCATAAAAGCTCTTTGGGG - Intronic
935970587 2:108527379-108527401 TATGGCATGAAAGGTCTACATGG - Intergenic
936419595 2:112350511-112350533 TATGGCATGAAAGGTCTACATGG + Intergenic
938326070 2:130404138-130404160 TATTGCTTAAAAGCTATACCAGG + Intergenic
938363872 2:130717327-130717349 TATTGCTTAAAAGCTATACCAGG - Intergenic
938656665 2:133441905-133441927 TCTGTCATAAAAACTCTACCAGG + Intronic
938902028 2:135806556-135806578 TATGGCATAAAAGCTGGACAGGG - Intronic
939997332 2:148932145-148932167 TAAGTCAAAAAAGCCCTACAGGG + Intronic
940957277 2:159741859-159741881 TTTGGCATATAATCTCTAAATGG - Intronic
941318894 2:164030388-164030410 TTTGGCATAAAAGGTATAGAAGG - Intergenic
944379478 2:199091716-199091738 TAGGCCATAAGAGCTCTAAATGG - Intergenic
944613495 2:201435450-201435472 TTTGGCATAAAAGCTACCCAAGG + Intronic
945185741 2:207137635-207137657 TATGGAATATAAGCAGTACAGGG + Intronic
1168745869 20:239734-239756 TATATCATAAAGGATCTACATGG + Intergenic
1175238787 20:57531099-57531121 TATGGTAAGAAAGCTCAACATGG + Intergenic
1176002133 20:62836999-62837021 TAAAGCATAAAATATCTACACGG - Intronic
1176944982 21:14968871-14968893 TATAGCTTTATAGCTCTACAGGG + Intronic
1178271992 21:31199357-31199379 TATGGCACTTAGGCTCTACATGG + Intronic
1180240575 21:46501769-46501791 TATGGAAAAAAAGGTATACATGG - Intronic
1182313746 22:29427948-29427970 TATGGTATATAAGCCCTAGAGGG + Intergenic
949623790 3:5845855-5845877 TATAGTATATAATCTCTACAAGG + Intergenic
950294489 3:11816929-11816951 AATGGCAAAAAAGATATACATGG + Intronic
953155286 3:40365614-40365636 TATAGAATAAAGGCTTTACAAGG - Intergenic
956316194 3:67940175-67940197 TTTGGCATAAAAGCTTTACTAGG + Intergenic
956906826 3:73774706-73774728 AATAGCATAAAAGCTCTACTTGG - Intergenic
957744356 3:84319284-84319306 TGTGGAATAAAAGCTCTACTGGG - Intergenic
963535192 3:146519513-146519535 TATTGGATAAAAGGTCTACTAGG + Intronic
964519805 3:157552750-157552772 TCTGGCATAAAACATCAACATGG - Intronic
965237830 3:166149513-166149535 TATGGCATTAAAACTTTAGAAGG + Intergenic
970049817 4:11901114-11901136 TATGGCACAAAAGCTGAAGAGGG - Intergenic
970495490 4:16620706-16620728 TCTTGAATACAAGCTCTACAGGG + Intronic
971366319 4:25979979-25980001 CATGGCATAAAAGCCCAGCATGG - Intergenic
973646693 4:52957208-52957230 TCTGGCAGAACAGCTCTGCAGGG - Intronic
973807017 4:54536004-54536026 TATGGAATGAAAGCACTAGAAGG - Intergenic
974183922 4:58420906-58420928 TAGGTCATAAAATCTCTCCATGG - Intergenic
975506735 4:75146572-75146594 TATGGCAGAAAATCTACACATGG + Intergenic
976372596 4:84307170-84307192 TGTGGTATCAAAGCACTACATGG - Intergenic
978219880 4:106256842-106256864 TATCTTATAAAAGCTATACATGG + Intronic
979014448 4:115415333-115415355 TATGGCATAAAACATCTATATGG + Intergenic
980734030 4:136859669-136859691 TATGGCTTAAAATCTCTACGGGG + Intergenic
983041941 4:162939595-162939617 TATGACAAATAAGCTCTACTGGG - Intergenic
986710475 5:10484972-10484994 TGTGGCAGAAAAATTCTACAGGG + Intergenic
987304566 5:16625329-16625351 TATGCCATAAAAGGCCTACGGGG + Intergenic
987691866 5:21277407-21277429 TGTAGGATAAAAGCTCTACATGG - Intergenic
988855752 5:35226831-35226853 TCTGGCATAGAAGCTCCACAAGG + Intronic
989205955 5:38809270-38809292 TATGACAGAAAAGCTTTACTTGG - Intergenic
989812927 5:45698541-45698563 TATGGCCTAGAAGCTATACTTGG - Intergenic
991223216 5:64239844-64239866 AATGTCATAAAAGTTCTACTTGG + Intronic
991748520 5:69772701-69772723 TGTAGGATAAAAGCTCTACATGG + Intergenic
991800100 5:70352546-70352568 TGTAGGATAAAAGCTCTACATGG + Intergenic
991828500 5:70657493-70657515 TGTAGGATAAAAGCTCTACATGG - Intergenic
991892455 5:71351973-71351995 TGTAGGATAAAAGCTCTACATGG + Intergenic
993054323 5:82964634-82964656 TATGGCCTACAGGCCCTACATGG - Intergenic
995239750 5:109872611-109872633 CATGGCCTAAAAGCCCTACCTGG + Intergenic
996821370 5:127632550-127632572 TATGGCTTATAAGCTCTGGATGG + Intergenic
998083447 5:139295518-139295540 TGTGATATAAAAGCTGTACACGG - Intronic
999139652 5:149350517-149350539 TATGGCATACATTCTCAACAGGG - Intronic
1002867079 6:1131087-1131109 AGTGACATAAATGCTCTACAGGG + Intergenic
1004764589 6:18711679-18711701 TATTACATATAAACTCTACAAGG + Intergenic
1004788280 6:18994042-18994064 TAAAGTATATAAGCTCTACAAGG + Intergenic
1005270105 6:24154561-24154583 TATGCAATAAAACCACTACATGG + Intronic
1009635772 6:66262620-66262642 TATGGCATAAAAGCTCTACATGG - Intergenic
1010008632 6:71024906-71024928 TAAGGCAAAAGACCTCTACAAGG - Intergenic
1011525934 6:88264772-88264794 TTTAGCCTAAAAGCTCTAAAAGG + Intergenic
1017100264 6:150843256-150843278 TACTGTATAAAAGGTCTACATGG + Exonic
1019161703 6:170073026-170073048 TATGACATAAAAACTAGACAAGG - Intergenic
1019833338 7:3356013-3356035 TATGGCCTATAAGCACTATAAGG - Intronic
1020153397 7:5701534-5701556 TTTTGCACAAAAGCTCTACGAGG + Intronic
1023770223 7:43550339-43550361 TATGCCAAAAATCCTCTACAGGG - Intronic
1024124386 7:46277246-46277268 TATGGCATAACTGCACTAAATGG - Intergenic
1027870260 7:83697611-83697633 AAAGGCATAAAAGCACTAGAGGG + Intergenic
1029026927 7:97426305-97426327 AATGGCACAAGATCTCTACATGG + Intergenic
1030946475 7:115728235-115728257 TGTGGCTTAAAGGCTCTTCATGG - Intergenic
1033912653 7:146284384-146284406 AATTACATAAAAGCTTTACAAGG + Intronic
1033991816 7:147297138-147297160 TATGGCTTCTCAGCTCTACACGG - Intronic
1035766169 8:2107386-2107408 GATGGCATAAATGATCTCCAGGG + Intronic
1036200352 8:6765745-6765767 TATGGCATTATATCTCCACAGGG + Intergenic
1037842639 8:22256171-22256193 CATGGCCTAAAAGCCCTCCAGGG - Intergenic
1038685534 8:29714236-29714258 TAAGGCATAAAAACACCACATGG + Intergenic
1040819248 8:51536969-51536991 TCTGGCATAAAAGCTGTGCCAGG - Intronic
1041614893 8:59894894-59894916 TATGGAAGAGAACCTCTACAGGG + Intergenic
1041694650 8:60722876-60722898 TATTACATCAAAACTCTACAAGG + Intronic
1047545465 8:125812122-125812144 TATATCACAAAAGCTCTCCAAGG - Intergenic
1050234535 9:3563787-3563809 TATGGCATAAAAGGTAAAAATGG + Intergenic
1050321902 9:4460847-4460869 TTTGGCGTTAAAGCTCTTCAAGG - Intergenic
1056940349 9:90950115-90950137 TGTGGCATAACAGCTCAACCAGG - Intergenic
1058725976 9:107804528-107804550 TATGGCAAAAAAAATGTACATGG + Intergenic
1186167787 X:6845222-6845244 TATGGAATATAAGACCTACAAGG + Intergenic
1186951443 X:14629831-14629853 TATAGTATAAGAGCCCTACAAGG + Intronic
1188272828 X:28162522-28162544 TTTGGCATAAATGCTTTATAGGG + Intergenic
1188361439 X:29259757-29259779 TATGACATATAACCTATACATGG + Intronic
1190109369 X:47580011-47580033 TTTGGGAAAAATGCTCTACATGG + Intronic
1192105070 X:68307530-68307552 TATGCCATAAAAGCTGCATAAGG + Intronic
1197826287 X:130593935-130593957 GGTGGCATGAAAGGTCTACATGG - Intergenic
1198034910 X:132792270-132792292 CATGGCATCAATGCTCTTCAAGG + Intronic
1200763263 Y:7059063-7059085 TATGGCATAAAAGCTCTACATGG + Intronic
1200769243 Y:7108364-7108386 TATGGCATAAAAGCTCTACATGG - Intergenic
1200886401 Y:8275719-8275741 TAAAGCAAAAAAGCTCTAAAGGG + Intergenic
1200952097 Y:8908007-8908029 TAAAGCAAAAAAGCTCTAAAGGG - Intergenic
1201059482 Y:10032737-10032759 TAAAGCCAAAAAGCTCTACAGGG + Intergenic
1201673602 Y:16553802-16553824 TATTACATAAAAGATCAACACGG + Intergenic