ID: 1009635774

View in Genome Browser
Species Human (GRCh38)
Location 6:66262638-66262660
Sequence ACAGAATGTTGGACCAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 27, 1: 41, 2: 36, 3: 21, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009635774_1009635777 -4 Left 1009635774 6:66262638-66262660 CCATAGTTGGTCCAACATTCTGT 0: 27
1: 41
2: 36
3: 21
4: 124
Right 1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG No data
1009635774_1009635778 0 Left 1009635774 6:66262638-66262660 CCATAGTTGGTCCAACATTCTGT 0: 27
1: 41
2: 36
3: 21
4: 124
Right 1009635778 6:66262661-66262683 GGACCACTAACGAGCAAGGATGG No data
1009635774_1009635780 14 Left 1009635774 6:66262638-66262660 CCATAGTTGGTCCAACATTCTGT 0: 27
1: 41
2: 36
3: 21
4: 124
Right 1009635780 6:66262675-66262697 CAAGGATGGACTTCCCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009635774 Original CRISPR ACAGAATGTTGGACCAACTA TGG (reversed) Intergenic
902051987 1:13571009-13571031 ACAGAACATTGGACCAACTACGG - Intergenic
904712955 1:32444772-32444794 ACAGAATGTTTGACCAATTACGG + Intergenic
905061150 1:35140156-35140178 ACAGAATGTTGGACCAACTATGG + Intergenic
910808072 1:91208389-91208411 ACAGAACGTTGGACCAACTACGG + Intergenic
910852952 1:91666510-91666532 ACAGAATGTTGGACCAACTATGG + Intergenic
910860119 1:91734658-91734680 ACAGAATGTTGGACCTGGAAGGG - Intronic
912816028 1:112829340-112829362 ACAGAACGTTGGACCAACTACGG - Intergenic
912980411 1:114366016-114366038 ACAGAACGTTGGACCAACTACGG + Intergenic
913231858 1:116746605-116746627 ATAGAATTTTGGACAAGCTACGG - Intergenic
913256992 1:116962785-116962807 ACAGATTGTTGGCCCCAGTAAGG - Intronic
913995738 1:143651003-143651025 ATACAATGTTGGACCCACCAAGG + Intergenic
917191752 1:172425589-172425611 ACAGAATGTTGGTCAAACCCTGG + Intronic
922680765 1:227593441-227593463 ACAGAATGTTGGACCAGCTATGG + Intronic
922690160 1:227682663-227682685 ACAGAATGTTGGACCAACTATGG - Intergenic
924550464 1:245071360-245071382 ACAGAATGTTGGTAGAAATATGG + Intronic
924859065 1:247902385-247902407 ACAGAACATTGGACCAACTATGG + Intergenic
1063295158 10:4797799-4797821 AAAGAATGTTGGAGCAAAAAAGG - Intronic
1064198922 10:13268226-13268248 TTAGAATGTTGGAACAACGAAGG + Intergenic
1064756516 10:18576433-18576455 ACAGAATGTTGGACCAACTATGG - Intronic
1065931011 10:30479130-30479152 ACAGAATGTTGGACCAACTACGG - Intergenic
1068671792 10:59730531-59730553 ACAGAACGTTGGACCAACTATGG + Intronic
1068675791 10:59768008-59768030 ACAGAATGTTGGACCAACTATGG + Intergenic
1069139038 10:64801081-64801103 TCAGAATGTTGGAAGAAATATGG - Intergenic
1069748215 10:70729428-70729450 CCAGAGTGTTGGACCAGCAATGG + Intronic
1069932518 10:71892234-71892256 AAAGAAAGTGGGACAAACTAGGG - Intergenic
1069939251 10:71943141-71943163 ACAGAACATTGGACCAACTATGG - Intergenic
1070397407 10:76023490-76023512 ACTGAATGGTGGAACAATTAAGG + Intronic
1071283125 10:84120737-84120759 ACAGAATGTTGGACCAACTATGG + Intergenic
1076348449 10:129797026-129797048 ACGGACAGTTGAACCAACTAAGG - Intergenic
1077628078 11:3791210-3791232 AAAGAATGATTGACAAACTATGG + Intronic
1079739253 11:24036761-24036783 GCAGAATGTTGGACATACAAGGG + Intergenic
1081209011 11:40308936-40308958 ACAGAATGTTGGTAGAAATATGG - Intronic
1082070421 11:47935205-47935227 ACTGATTGTTGGATCCACTAAGG - Intergenic
1083082194 11:60105426-60105448 AGTGAATGTTGGACCAACTATGG + Intergenic
1083089897 11:60189118-60189140 ACAGAACGTTGGACCAACTATGG - Intergenic
1085760786 11:79239481-79239503 GCAGAGTGTGGGACCAACTTAGG + Intronic
1086853647 11:91840650-91840672 ACAAAATGATGGTCCAACCAAGG - Intergenic
1086973458 11:93107571-93107593 ACAGAACATTGGACCAACAACGG + Intergenic
1087612148 11:100447537-100447559 ACATAATGTTGGTAGAACTATGG + Intergenic
1087684519 11:101248227-101248249 ACAGAACGTTGGACCAACTATGG - Intergenic
1087894813 11:103575723-103575745 ACAGAACGTTGGACTGACTATGG - Intergenic
1089663302 11:119999855-119999877 ACAGAATGTTGGTGGAAATATGG + Intergenic
1090174520 11:124636732-124636754 ACAGACCCTTAGACCAACTAGGG + Exonic
1090245420 11:125212789-125212811 AAAGGATGTGGGAGCAACTAGGG - Intronic
1090525777 11:127533820-127533842 ACAGAATGTTGCAGCCACTATGG - Intergenic
1091566056 12:1649003-1649025 ACAGAATGTTGGAGCAGGAAGGG + Intergenic
1091814513 12:3426407-3426429 ACAGAACGTTGGACCAACTATGG + Intronic
1092252460 12:6907572-6907594 ACAGCATCTGGAACCAACTATGG - Intronic
1092267265 12:6991722-6991744 AAAGAATGATAGACAAACTATGG - Intronic
1093356749 12:18176355-18176377 ATAGAATGCTGGAACAACTATGG - Intronic
1093594108 12:20941100-20941122 ACAGAACATTGGACCAACTATGG + Intergenic
1093789067 12:23226018-23226040 ACAGAATGTCAGAGCAAGTAGGG + Intergenic
1096050171 12:48600533-48600555 ATAGAACATTGGACCAACTTCGG - Intergenic
1098248397 12:68543899-68543921 ACAGAATGTTGGACCAACTATGG - Intergenic
1099403376 12:82227891-82227913 ACAGAATGTAGAACCAAATAGGG - Intronic
1099982119 12:89616785-89616807 ACAGAATGTTTCACCACCTCAGG + Exonic
1100779454 12:98008522-98008544 ACAGAATGTTGGTAGAAATATGG + Intergenic
1102606388 12:114070956-114070978 ACAGAACATCAGACCAACTACGG - Intergenic
1105569472 13:21588082-21588104 GCAGAACGTTGGACCAACTATGG - Intronic
1106641177 13:31586031-31586053 ACAGAATGTTGGTAGAAATATGG + Intergenic
1110653705 13:77972484-77972506 ACAGAATGTTGGACCAACTATGG + Intergenic
1112779069 13:102878246-102878268 ACTGAATGTTGGACAGTCTATGG + Intergenic
1114223498 14:20717764-20717786 ACAGAATGTTGGACCAACTGTGG + Intergenic
1114236083 14:20824898-20824920 ACAGAACGTTGGACCAACTACGG + Intergenic
1114335346 14:21683668-21683690 ACAGAATGATGGTCCCACCAGGG - Intergenic
1115211369 14:30970346-30970368 ACAGAACGTTGGACCAACTACGG - Intronic
1117179539 14:53177937-53177959 ACAGAATGTTGGACCAACTATGG + Intergenic
1117373224 14:55097619-55097641 ACAGAATGTTGGGCCATAAAGGG - Intergenic
1117581085 14:57152454-57152476 ACAGGATGTTGGTACAAATATGG + Intergenic
1117913217 14:60653550-60653572 ACAGACTGATGGACCGACTGAGG + Intronic
1117955193 14:61117422-61117444 ACAGAATATTGGACCAACTATGG + Intergenic
1118105929 14:62659615-62659637 ACAGAATGTTGGTAAAAATATGG + Intergenic
1121664357 14:95660638-95660660 AGAGAGTGTTGGAAGAACTAAGG - Intergenic
1122826108 14:104371457-104371479 ACAGAAAGCTGGACCAACGGTGG + Intergenic
1124515173 15:30361677-30361699 ACAGACTGTTGGTCTTACTAAGG - Exonic
1124727749 15:32169050-32169072 ACAGACTGTTGGTCTTACTAAGG + Intronic
1125392327 15:39207330-39207352 ACAGAATGTTGGTAGAAATATGG + Intergenic
1125690328 15:41591024-41591046 ACAGAACATCGGACCAACTACGG - Intergenic
1127429570 15:58889566-58889588 ACAGAATGAAGAACCAACCAAGG + Intronic
1131678541 15:94697512-94697534 ACTGAATGTTGTACCAGGTATGG + Intergenic
1136183015 16:28567702-28567724 ACAGAATGTTGGTGGAAATATGG + Intronic
1136925808 16:34372718-34372740 ACAGAATGTGGGAGAAATTAAGG + Intergenic
1136978766 16:35039088-35039110 ACAGAATGTGGGAGAAATTAAGG - Intergenic
1137908110 16:52346584-52346606 ACATAAAATTGGAGCAACTAGGG + Intergenic
1138078300 16:54064644-54064666 ACAGAATGAGGGAGCAAGTAGGG - Intronic
1141284839 16:82661828-82661850 ACACAATTTAGGAACAACTAAGG + Intronic
1144095546 17:11897322-11897344 AAAGATTGTTGGAACAACTTGGG - Intronic
1147810304 17:43164258-43164280 ACAGAACGTTGGACCAACTACGG + Intergenic
1148828961 17:50416770-50416792 ACAGAATGTTGGACCAACTACGG + Intergenic
1152454950 17:80409437-80409459 ACAGAATGTTGGACCAACTACGG - Intergenic
1153826376 18:8878754-8878776 ACAGAATGTTGGACCAACTATGG + Intergenic
1153830388 18:8917338-8917360 ACAGAATGTTGGACCAACTATGG - Intergenic
1154014129 18:10601458-10601480 ACAGAACATTGGACCAACTAAGG + Intergenic
1155746195 18:29358612-29358634 ACAGAATGTTGGATCGACTGTGG + Intergenic
1156358435 18:36362389-36362411 ACAGAATGGTGGACTAGTTAGGG + Intronic
1162267805 19:9590149-9590171 ACAGAACGTTGGACCAACTACGG + Intergenic
1162281902 19:9705475-9705497 ACAGAACGTTGGACCAACTATGG - Intergenic
1163991853 19:21006317-21006339 ACAGAATGTTGGACCAACTATGG - Intergenic
1164011908 19:21210878-21210900 ACAGACTGTTGGAGCAGCTGAGG + Intergenic
1164121565 19:22269915-22269937 ACAGAAAGTTGGACCAGCTATGG + Intergenic
1164130720 19:22358846-22358868 ACAGAATGTTGGATCAACTATGG + Intergenic
1164216955 19:23158937-23158959 AAAGAACGTTGGACCAACTATGG + Intergenic
1164292831 19:23882591-23882613 ACACAGTGTTAGAGCAACTAGGG + Intergenic
1164773189 19:30828658-30828680 ATAGAATGTCTGACCAATTATGG + Intergenic
925304993 2:2841903-2841925 ACAGAATGTTGGTAGAAATATGG + Intergenic
926491450 2:13530023-13530045 ACAGAACGTTGGACCAACTATGG + Intergenic
930531585 2:52595381-52595403 ACAGAATCTTGGCCAATCTAGGG + Intergenic
931352242 2:61501922-61501944 ACAAAATGTTCGACCTACTTAGG - Intronic
932315026 2:70774587-70774609 ACAGAATGTTGGTAGAAATAAGG + Intergenic
933389461 2:81652055-81652077 ACAGAAGGTTGGACCAACTATGG + Intergenic
935048419 2:99502603-99502625 ACAGAACATTGGACCAACTAGGG - Intergenic
935144533 2:100386260-100386282 ACAGAATGTTGGTAGAAATATGG + Intergenic
935721485 2:105983165-105983187 ACAGAACGTTGGACCAACTATGG + Intergenic
935970590 2:108527397-108527419 ACAGAACGTTGGACCAACTATGG - Intergenic
936419592 2:112350493-112350515 ACAGAACGTTGGACCAACTATGG + Intergenic
936508477 2:113127132-113127154 ACAGAATGTTTGCCAATCTATGG + Intronic
936716327 2:115191258-115191280 ACAGAGCATTGGACCAACTTCGG + Intronic
938703167 2:133897448-133897470 ACAGAACATTGGACCAACTACGG - Intergenic
940649805 2:156431015-156431037 AATGAATGGTGGACCAACTTAGG + Intergenic
941772337 2:169358700-169358722 ATATAATGTTGGACCAGGTAAGG + Intronic
942807389 2:179947929-179947951 ACAGTATCTTGGTCCAAATAAGG - Intronic
942840197 2:180350832-180350854 ACAGACTATTGCACCAACCATGG + Intergenic
943126516 2:183799921-183799943 ACAGTATGATGGACAAACTTTGG - Intergenic
943408094 2:187514060-187514082 ACGGAATGTTGGACCAACTATGG - Intronic
945289741 2:208115475-208115497 ACAGAATGTTGGACAAACTGCGG - Intergenic
946074382 2:217061852-217061874 GCAGAATGATGGATCAACTCTGG - Intergenic
946185961 2:217980438-217980460 CCACACTGTTGGACCAACAAAGG - Intronic
947116274 2:226774486-226774508 ACAGAATGTTGGACAATTTGGGG + Intronic
1168824204 20:798360-798382 ACAGAACTTTGGACCAACTATGG - Intergenic
1170482312 20:16778325-16778347 AAAAAATGTTGGAGCAACTGTGG - Intergenic
1173277572 20:41597996-41598018 ATAGAACATTGGACCAGCTATGG - Intronic
1173547187 20:43907353-43907375 ACAGAATTTTAGACCAATTTTGG + Intergenic
1175513870 20:59555635-59555657 ACAGAACGTTGGACTAACTGTGG + Intergenic
1179380312 21:40892606-40892628 AAAGAATTTTGTACCAATTATGG + Intergenic
1179670880 21:42946813-42946835 ACAGGACGTTGGACCAACTATGG + Intergenic
949609892 3:5693230-5693252 ACAGAGCATTGGACCAACTTCGG + Intergenic
950227738 3:11249712-11249734 ATAGAACATTGGACCAACTGTGG + Intronic
950594287 3:13965215-13965237 ACAGAACGTTGGACCAACTATGG + Intronic
950846136 3:16017738-16017760 ACAGAACACTGGACCAAGTACGG + Intergenic
951400271 3:22224779-22224801 CCAGAAAGTTGGACCAACTTAGG - Intronic
952660377 3:35839482-35839504 ACACAAAGGTGGGCCAACTATGG + Intergenic
954355107 3:50078351-50078373 ACAGAAGGCTGGACCAAGGAGGG + Intronic
954604746 3:51900648-51900670 ACAGAACCCTGGACCAACTATGG - Intronic
956885618 3:73556569-73556591 ATAGAATGTTGGATAAAATATGG + Intronic
957999915 3:87737630-87737652 ATAGAATGTTGGACCAACTATGG + Intergenic
960720354 3:120619168-120619190 AAAGAACATTGGACCAACTATGG + Intergenic
961174749 3:124825254-124825276 ACAAAATGTTTCACCAACTCTGG + Intronic
962096742 3:132300130-132300152 ACAGAACATTGGACCAACTATGG + Intergenic
962097374 3:132306337-132306359 ACAGAATGTTGGACCAACTATGG - Intergenic
962277072 3:134023559-134023581 ACAGAACATTGGACCAACTATGG - Intronic
963146801 3:142002554-142002576 ACAGAATGTTGGCACAAATATGG - Intronic
964933013 3:162048582-162048604 ACAGAACATTGGACCAACTATGG + Intergenic
965796062 3:172439858-172439880 ACTGAATGTTGGACAAATGAAGG - Intergenic
966750076 3:183313567-183313589 ACGGAAAGATGGAGCAACTACGG + Intronic
969076771 4:4585495-4585517 ACAGAATGTTGGTGGAAATATGG + Intergenic
970092600 4:12427182-12427204 ACAGAACATTGGACCAACTACGG + Intergenic
971350087 4:25847846-25847868 TCAGAATGTTGTACCATCTTTGG - Exonic
971486234 4:27163317-27163339 ACAGAATGTTGGTAGAAATATGG - Intergenic
972217060 4:36909305-36909327 ACAGAACGTTGGACCAACTATGG - Intergenic
972784988 4:42318427-42318449 ACAGAACATTGGATCGACTATGG - Intergenic
972991221 4:44824171-44824193 ACAGAACGTTGGACCAACTATGG + Intergenic
974492579 4:62586486-62586508 ATAGAATGATGGACAAACTATGG - Intergenic
977043568 4:92042464-92042486 ACAGAATGTTGGACCAACTACGG + Intergenic
977349240 4:95859585-95859607 AAAGAATGATTGACAAACTATGG - Intergenic
977785199 4:101025386-101025408 ACAAAATGATGTACAAACTAAGG - Exonic
978314183 4:107417716-107417738 ACAGAATGTTGGACTAACTATGG - Intergenic
979388758 4:120101379-120101401 ACAGAATGTTGGCAAAAATATGG - Intergenic
980073003 4:128263594-128263616 ACAGAACGTTGGGCCAACTATGG - Intergenic
980902399 4:138917328-138917350 ACAGGATGTTGGTAGAACTATGG - Intergenic
983634213 4:169881462-169881484 TCAGAATGTTGGTCGAAATATGG + Intergenic
983708443 4:170686766-170686788 ACAGAACATTGGACCAACTATGG - Intergenic
983897977 4:173102181-173102203 ACAGAACGTTGGACCAACTATGG - Intergenic
984867370 4:184293431-184293453 ACTGAATTTTGGTCCACCTATGG + Intergenic
985069388 4:186152999-186153021 ACAGAAATCTTGACCAACTAGGG + Intronic
987930536 5:24394887-24394909 ACAGAATGTTGGACCAACTATGG + Intergenic
989096041 5:37782141-37782163 GCAGAACGTTGGACCAACTATGG + Intergenic
989771650 5:45153258-45153280 ACAGAATATTGGACTGACTCAGG + Intergenic
990882240 5:60552216-60552238 ACAGAATGTTTGAGCCACGAAGG - Intergenic
991965884 5:72090147-72090169 AGAGAATGATGGACAAACTGTGG + Intergenic
995867432 5:116706650-116706672 ACAGAATGTTGGACCAACTATGG - Intergenic
998475567 5:142418440-142418462 ACAAAATGGTGGAACTACTATGG - Intergenic
999053644 5:148550647-148550669 ACACAAAGTTGGACCAAATTGGG - Intronic
1000236829 5:159369803-159369825 ACAGAACGTTGGACCAACTATGG - Intergenic
1001490681 5:172152684-172152706 TAAGAATGTTGGAACAACTTGGG + Intronic
1001558437 5:172652562-172652584 ACAGAACGTTGGACCAACTACGG + Intronic
1002999115 6:2314454-2314476 ACAGAATGTTGGACCAACTACGG + Intergenic
1003246730 6:4388234-4388256 ATAGAACATTGGACCAACTTCGG - Intergenic
1004642195 6:17526348-17526370 ACAGAAGGTTGGATCACCTGAGG - Intronic
1005246210 6:23888254-23888276 ACAGTATGTTGGAGAAAATAAGG + Intergenic
1005461939 6:26077681-26077703 ACACAACATTCGACCAACTATGG - Intergenic
1005588953 6:27304982-27305004 ACAGAATGATAGACCTAATAGGG + Intronic
1006325770 6:33352747-33352769 ACAGAACGTTGGACCGACTACGG + Intergenic
1009449918 6:63788924-63788946 ACAGACTATTGTACCAACTAGGG - Intronic
1009635774 6:66262638-66262660 ACAGAATGTTGGACCAACTATGG - Intergenic
1011352306 6:86435801-86435823 AAAGAATGTGGGAACAACAAAGG + Intergenic
1015171931 6:130263878-130263900 ACAGAATGTTGGACCAACTATGG - Intronic
1018191375 6:161311851-161311873 ACAGAATGCTGGACCAACTATGG + Intergenic
1020043887 7:5025235-5025257 ACAGAACGTTGGACCAACTATGG + Intronic
1020377532 7:7504764-7504786 ATAGAATGTTTGAGCCACTAGGG - Intronic
1021849353 7:24792307-24792329 ACAGAACGTTGGACCAATTATGG + Intergenic
1023436338 7:40144044-40144066 ACAGAATGTTGGACAAACTACGG + Intronic
1023799111 7:43818093-43818115 ACAGAACATTGGATCAACTATGG - Intergenic
1023799511 7:43821747-43821769 ACAGAATGTAGGACCAACTACGG - Intergenic
1024143696 7:46488448-46488470 ACAGAATTTTGGAACATCTCAGG - Intergenic
1024414173 7:49082832-49082854 ACAGAATGTTGGTACAAATATGG - Intergenic
1028333987 7:89628798-89628820 ACAGAACGTTGGACTAACTATGG - Intergenic
1029486099 7:100842530-100842552 ACAGAACATTGGACCAACTATGG - Intronic
1029822073 7:103156191-103156213 ACAGAACATTGGACCAACTATGG - Intergenic
1030071694 7:105703488-105703510 TCAGAATGTTGGACCAAATATGG - Intronic
1032170558 7:129581164-129581186 ACAGAATGTTGGACCAACTATGG - Intergenic
1033097535 7:138443853-138443875 ACAGAACATTGGACCAACTACGG + Intergenic
1040861975 8:52008450-52008472 ACAGAATGTTGCTACAACGATGG - Intergenic
1040993395 8:53376146-53376168 ACAGAATGTTGGACCAACTATGG + Intergenic
1041227139 8:55711974-55711996 ACAGAATGTTGGACTAACTACGG - Intronic
1041515471 8:58694785-58694807 ACAGAACATTGGACCAACTATGG - Intergenic
1042087871 8:65128431-65128453 ACAGAACGTTGGACCAACTATGG + Intergenic
1044184583 8:89236387-89236409 ACAGAACGTTGGACCAACTATGG + Intergenic
1049053097 8:140214531-140214553 AAAGAAGGTTGGACCAAGTTAGG - Intronic
1052101968 9:24458777-24458799 AAAGAATGTAGAAGCAACTATGG + Intergenic
1052508090 9:29380828-29380850 ACAGAATGTTGGACCAACTATGG - Intergenic
1053110736 9:35457578-35457600 ACAGAACGTTGGACCAACTACGG + Intergenic
1053422138 9:37986398-37986420 ACAGAAGGTGGGGCCAGCTATGG + Intronic
1056414417 9:86362505-86362527 ACAGAACGTAGGACCAACTACGG + Intergenic
1187612362 X:20956206-20956228 ACAGAATGTTGGTAGAAATATGG - Intergenic
1189034569 X:37482603-37482625 ACAGAATGTTGGACTAACTACGG - Intronic
1190537214 X:51441275-51441297 ACAAAATGTTGGTCGAAATATGG + Intergenic
1190771221 X:53516382-53516404 ACAGAACTTTGGACCAACTATGG - Intergenic
1191103367 X:56757526-56757548 ACAAAATGAGGAACCAACTAAGG + Intergenic
1191202064 X:57794020-57794042 ACAGAATGTTGGTAGAAATATGG - Intergenic
1191639240 X:63412648-63412670 ACAGAACATTGGACCAACTACGG - Intergenic
1191871131 X:65746457-65746479 AGAGAATGTGAGACCAACTCAGG - Intergenic
1191917975 X:66222613-66222635 ACAGAATGTTGGGCCAACTATGG + Intronic
1192915465 X:75646697-75646719 ACAGAATGTTGGACCAACTATGG + Intergenic
1193343179 X:80376480-80376502 AAAGAATGTTTGACCAAAGATGG - Intronic
1193593305 X:83417160-83417182 ACAGAATGGTAGACAAGCTAAGG + Intergenic
1193717335 X:84948395-84948417 ACAGAACGTTGGACCAACTATGG - Intergenic
1195677654 X:107519619-107519641 AGTGAATGTGGGACCAACTTAGG + Intergenic
1196422994 X:115541730-115541752 ACAGAACATTGGACCAACTATGG + Intergenic
1196460072 X:115920478-115920500 ACAGAATGTTGGACCAACTACGG - Intergenic
1196594111 X:117523068-117523090 ACATAATATTGGAACTACTAGGG + Intergenic
1196869414 X:120098705-120098727 ACAGAACTTTGGACCAACTACGG - Intergenic
1197265162 X:124361570-124361592 ACAGAATGTTGGTAGAACTATGG + Intronic
1198248593 X:134856574-134856596 ACAGAATGGAGAACCAACTATGG - Intergenic
1199676591 X:150194805-150194827 ACAGAATGTGGGGCGATCTATGG - Intergenic
1200278706 X:154758478-154758500 ACAGAATGTTGGAAGAGGTATGG - Intergenic
1200763261 Y:7059045-7059067 ACAGATCATTGGACCAACTATGG + Intronic
1200769245 Y:7108382-7108404 ACAGATCATTGGACCAACTATGG - Intergenic
1201308909 Y:12576847-12576869 ACAGAATGTGGGACCAGCTATGG - Intergenic
1201911938 Y:19141657-19141679 ACAGAACATTGGGCCAACTATGG - Intergenic