ID: 1009635777

View in Genome Browser
Species Human (GRCh38)
Location 6:66262657-66262679
Sequence CTGTGGACCACTAACGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009635771_1009635777 15 Left 1009635771 6:66262619-66262641 CCCATGTAGAGCTTTTATGCCAT 0: 20
1: 35
2: 31
3: 19
4: 135
Right 1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG No data
1009635770_1009635777 16 Left 1009635770 6:66262618-66262640 CCCCATGTAGAGCTTTTATGCCA 0: 3
1: 24
2: 46
3: 39
4: 125
Right 1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG No data
1009635769_1009635777 17 Left 1009635769 6:66262617-66262639 CCCCCATGTAGAGCTTTTATGCC 0: 3
1: 35
2: 49
3: 38
4: 101
Right 1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG No data
1009635772_1009635777 14 Left 1009635772 6:66262620-66262642 CCATGTAGAGCTTTTATGCCATA 0: 3
1: 0
2: 3
3: 13
4: 149
Right 1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG No data
1009635774_1009635777 -4 Left 1009635774 6:66262638-66262660 CCATAGTTGGTCCAACATTCTGT 0: 27
1: 41
2: 36
3: 21
4: 124
Right 1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009635777 Original CRISPR CTGTGGACCACTAACGAGCA AGG Intergenic
No off target data available for this crispr