ID: 1009641699

View in Genome Browser
Species Human (GRCh38)
Location 6:66345711-66345733
Sequence ACCAGAAATGACTCTAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009641699_1009641702 19 Left 1009641699 6:66345711-66345733 CCATGTCTAGAGTCATTTCTGGT No data
Right 1009641702 6:66345753-66345775 CTAGTCCTTCTAGTCTGTAGAGG No data
1009641699_1009641701 -10 Left 1009641699 6:66345711-66345733 CCATGTCTAGAGTCATTTCTGGT No data
Right 1009641701 6:66345724-66345746 CATTTCTGGTTGTCGTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009641699 Original CRISPR ACCAGAAATGACTCTAGACA TGG (reversed) Intergenic
No off target data available for this crispr