ID: 1009646432

View in Genome Browser
Species Human (GRCh38)
Location 6:66408796-66408818
Sequence CTTTCTATGCTTTATGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009646432_1009646434 23 Left 1009646432 6:66408796-66408818 CCAATCACATAAAGCATAGAAAG No data
Right 1009646434 6:66408842-66408864 GAGAATCTCAAGGCTCTCCGTGG No data
1009646432_1009646435 24 Left 1009646432 6:66408796-66408818 CCAATCACATAAAGCATAGAAAG No data
Right 1009646435 6:66408843-66408865 AGAATCTCAAGGCTCTCCGTGGG No data
1009646432_1009646433 13 Left 1009646432 6:66408796-66408818 CCAATCACATAAAGCATAGAAAG No data
Right 1009646433 6:66408832-66408854 TCAGTAAATTGAGAATCTCAAGG No data
1009646432_1009646436 28 Left 1009646432 6:66408796-66408818 CCAATCACATAAAGCATAGAAAG No data
Right 1009646436 6:66408847-66408869 TCTCAAGGCTCTCCGTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009646432 Original CRISPR CTTTCTATGCTTTATGTGAT TGG (reversed) Intergenic
No off target data available for this crispr