ID: 1009646435

View in Genome Browser
Species Human (GRCh38)
Location 6:66408843-66408865
Sequence AGAATCTCAAGGCTCTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009646432_1009646435 24 Left 1009646432 6:66408796-66408818 CCAATCACATAAAGCATAGAAAG No data
Right 1009646435 6:66408843-66408865 AGAATCTCAAGGCTCTCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009646435 Original CRISPR AGAATCTCAAGGCTCTCCGT GGG Intergenic
No off target data available for this crispr