ID: 1009655488

View in Genome Browser
Species Human (GRCh38)
Location 6:66539716-66539738
Sequence CTAAAAGCCCAGAGTAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009655488_1009655493 8 Left 1009655488 6:66539716-66539738 CCCTGCTTACTCTGGGCTTTTAG No data
Right 1009655493 6:66539747-66539769 ATTAATCCCCCAGAGTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009655488 Original CRISPR CTAAAAGCCCAGAGTAAGCA GGG (reversed) Intergenic
No off target data available for this crispr