ID: 1009657191

View in Genome Browser
Species Human (GRCh38)
Location 6:66562321-66562343
Sequence CAAGCTACCCACATAGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009657191_1009657196 20 Left 1009657191 6:66562321-66562343 CCAGTATCTATGTGGGTAGCTTG No data
Right 1009657196 6:66562364-66562386 TTAAAAAGGAAAATAATTTGGGG No data
1009657191_1009657194 18 Left 1009657191 6:66562321-66562343 CCAGTATCTATGTGGGTAGCTTG No data
Right 1009657194 6:66562362-66562384 TGTTAAAAAGGAAAATAATTTGG No data
1009657191_1009657195 19 Left 1009657191 6:66562321-66562343 CCAGTATCTATGTGGGTAGCTTG No data
Right 1009657195 6:66562363-66562385 GTTAAAAAGGAAAATAATTTGGG No data
1009657191_1009657193 6 Left 1009657191 6:66562321-66562343 CCAGTATCTATGTGGGTAGCTTG No data
Right 1009657193 6:66562350-66562372 CAGGCTTCTCTTTGTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009657191 Original CRISPR CAAGCTACCCACATAGATAC TGG (reversed) Intergenic
No off target data available for this crispr