ID: 1009658896

View in Genome Browser
Species Human (GRCh38)
Location 6:66583918-66583940
Sequence CTGCCTTTTGTCTCCTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009658896_1009658897 18 Left 1009658896 6:66583918-66583940 CCAATATAGGAGACAAAAGGCAG No data
Right 1009658897 6:66583959-66583981 AGAGTTATATGCATGTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009658896 Original CRISPR CTGCCTTTTGTCTCCTATAT TGG (reversed) Intergenic
No off target data available for this crispr