ID: 1009660694

View in Genome Browser
Species Human (GRCh38)
Location 6:66606912-66606934
Sequence AACAGCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009660694_1009660701 16 Left 1009660694 6:66606912-66606934 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1009660701 6:66606951-66606973 GTTATTTGCAGAAGAGGGCACGG No data
1009660694_1009660699 10 Left 1009660694 6:66606912-66606934 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1009660699 6:66606945-66606967 AGGGTAGTTATTTGCAGAAGAGG No data
1009660694_1009660702 17 Left 1009660694 6:66606912-66606934 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1009660702 6:66606952-66606974 TTATTTGCAGAAGAGGGCACGGG No data
1009660694_1009660697 -10 Left 1009660694 6:66606912-66606934 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1009660697 6:66606925-66606947 AAGAGCTGTTTCTCAAAAGGAGG No data
1009660694_1009660698 -9 Left 1009660694 6:66606912-66606934 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1009660698 6:66606926-66606948 AGAGCTGTTTCTCAAAAGGAGGG No data
1009660694_1009660700 11 Left 1009660694 6:66606912-66606934 CCAGTAACAGGCCAAGAGCTGTT No data
Right 1009660700 6:66606946-66606968 GGGTAGTTATTTGCAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009660694 Original CRISPR AACAGCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr