ID: 1009663894

View in Genome Browser
Species Human (GRCh38)
Location 6:66651495-66651517
Sequence CCTACCACTTTGGTCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009663886_1009663894 27 Left 1009663886 6:66651445-66651467 CCAAGATTCTAACATAGCTCGGT No data
Right 1009663894 6:66651495-66651517 CCTACCACTTTGGTCTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009663894 Original CRISPR CCTACCACTTTGGTCTTGGT GGG Intergenic
No off target data available for this crispr