ID: 1009670416

View in Genome Browser
Species Human (GRCh38)
Location 6:66741407-66741429
Sequence CAAAATATGAGACATCGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009670416_1009670419 10 Left 1009670416 6:66741407-66741429 CCTGCTCGATGTCTCATATTTTG No data
Right 1009670419 6:66741440-66741462 GGACACAGACCACCAGCCATAGG No data
1009670416_1009670422 24 Left 1009670416 6:66741407-66741429 CCTGCTCGATGTCTCATATTTTG No data
Right 1009670422 6:66741454-66741476 AGCCATAGGCCCACTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009670416 Original CRISPR CAAAATATGAGACATCGAGC AGG (reversed) Intergenic
No off target data available for this crispr