ID: 1009670419

View in Genome Browser
Species Human (GRCh38)
Location 6:66741440-66741462
Sequence GGACACAGACCACCAGCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009670415_1009670419 30 Left 1009670415 6:66741387-66741409 CCACAACTTATGTATCTGATCCT No data
Right 1009670419 6:66741440-66741462 GGACACAGACCACCAGCCATAGG No data
1009670416_1009670419 10 Left 1009670416 6:66741407-66741429 CCTGCTCGATGTCTCATATTTTG No data
Right 1009670419 6:66741440-66741462 GGACACAGACCACCAGCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009670419 Original CRISPR GGACACAGACCACCAGCCAT AGG Intergenic
No off target data available for this crispr