ID: 1009670422

View in Genome Browser
Species Human (GRCh38)
Location 6:66741454-66741476
Sequence AGCCATAGGCCCACTGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009670416_1009670422 24 Left 1009670416 6:66741407-66741429 CCTGCTCGATGTCTCATATTTTG No data
Right 1009670422 6:66741454-66741476 AGCCATAGGCCCACTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009670422 Original CRISPR AGCCATAGGCCCACTGCCCC TGG Intergenic
No off target data available for this crispr