ID: 1009676304

View in Genome Browser
Species Human (GRCh38)
Location 6:66826830-66826852
Sequence GTGAATAAGCAGAAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009676304_1009676307 16 Left 1009676304 6:66826830-66826852 CCCTGCTGCTTCTGCTTATTCAC No data
Right 1009676307 6:66826869-66826891 CACCTTTTTTTAAACCTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009676304 Original CRISPR GTGAATAAGCAGAAGCAGCA GGG (reversed) Intergenic
No off target data available for this crispr