ID: 1009678127

View in Genome Browser
Species Human (GRCh38)
Location 6:66854355-66854377
Sequence GTGCCCAATCAGACTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009678127_1009678136 28 Left 1009678127 6:66854355-66854377 CCAACCTCAGTCTGATTGGGCAC No data
Right 1009678136 6:66854406-66854428 ACAAGGCAGACAAATAAGGTGGG No data
1009678127_1009678134 24 Left 1009678127 6:66854355-66854377 CCAACCTCAGTCTGATTGGGCAC No data
Right 1009678134 6:66854402-66854424 TAGAACAAGGCAGACAAATAAGG No data
1009678127_1009678135 27 Left 1009678127 6:66854355-66854377 CCAACCTCAGTCTGATTGGGCAC No data
Right 1009678135 6:66854405-66854427 AACAAGGCAGACAAATAAGGTGG No data
1009678127_1009678132 11 Left 1009678127 6:66854355-66854377 CCAACCTCAGTCTGATTGGGCAC No data
Right 1009678132 6:66854389-66854411 CTGCCAGTATATCTAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009678127 Original CRISPR GTGCCCAATCAGACTGAGGT TGG (reversed) Intergenic
No off target data available for this crispr