ID: 1009690955

View in Genome Browser
Species Human (GRCh38)
Location 6:67031347-67031369
Sequence GTGTTTACAAAGCTTTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009690955_1009690958 26 Left 1009690955 6:67031347-67031369 CCTAGCTAAAGCTTTGTAAACAC No data
Right 1009690958 6:67031396-67031418 CCGATCAGCTCTCTGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009690955 Original CRISPR GTGTTTACAAAGCTTTAGCT AGG (reversed) Intergenic
No off target data available for this crispr