ID: 1009697445

View in Genome Browser
Species Human (GRCh38)
Location 6:67125621-67125643
Sequence TTCTGTGTGCTGTAGGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009697441_1009697445 12 Left 1009697441 6:67125586-67125608 CCTCTTCCAAACACTCAGCTATT No data
Right 1009697445 6:67125621-67125643 TTCTGTGTGCTGTAGGATTGAGG No data
1009697443_1009697445 6 Left 1009697443 6:67125592-67125614 CCAAACACTCAGCTATTGGCAGA No data
Right 1009697445 6:67125621-67125643 TTCTGTGTGCTGTAGGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009697445 Original CRISPR TTCTGTGTGCTGTAGGATTG AGG Intergenic
No off target data available for this crispr