ID: 1009702283

View in Genome Browser
Species Human (GRCh38)
Location 6:67200617-67200639
Sequence GGCTCCCAGCAACCCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009702283_1009702284 -8 Left 1009702283 6:67200617-67200639 CCAGCTTGGGGTTGCTGGGAGCC No data
Right 1009702284 6:67200632-67200654 TGGGAGCCAAAAGCTGTCCCTGG No data
1009702283_1009702288 6 Left 1009702283 6:67200617-67200639 CCAGCTTGGGGTTGCTGGGAGCC No data
Right 1009702288 6:67200646-67200668 TGTCCCTGGACCCAGAGAAGGGG No data
1009702283_1009702286 4 Left 1009702283 6:67200617-67200639 CCAGCTTGGGGTTGCTGGGAGCC No data
Right 1009702286 6:67200644-67200666 GCTGTCCCTGGACCCAGAGAAGG No data
1009702283_1009702287 5 Left 1009702283 6:67200617-67200639 CCAGCTTGGGGTTGCTGGGAGCC No data
Right 1009702287 6:67200645-67200667 CTGTCCCTGGACCCAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009702283 Original CRISPR GGCTCCCAGCAACCCCAAGC TGG (reversed) Intergenic
No off target data available for this crispr