ID: 1009702457

View in Genome Browser
Species Human (GRCh38)
Location 6:67201713-67201735
Sequence CGGCAAACAGCAGTGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009702457_1009702471 30 Left 1009702457 6:67201713-67201735 CCATCCAACACTGCTGTTTGCCG No data
Right 1009702471 6:67201766-67201788 CTCTGGATATCGCAGGGTGTCGG No data
1009702457_1009702465 23 Left 1009702457 6:67201713-67201735 CCATCCAACACTGCTGTTTGCCG No data
Right 1009702465 6:67201759-67201781 TCCACCCCTCTGGATATCGCAGG No data
1009702457_1009702463 13 Left 1009702457 6:67201713-67201735 CCATCCAACACTGCTGTTTGCCG No data
Right 1009702463 6:67201749-67201771 ACCGCTGACTTCCACCCCTCTGG 0: 3
1: 47
2: 103
3: 128
4: 166
1009702457_1009702467 24 Left 1009702457 6:67201713-67201735 CCATCCAACACTGCTGTTTGCCG No data
Right 1009702467 6:67201760-67201782 CCACCCCTCTGGATATCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009702457 Original CRISPR CGGCAAACAGCAGTGTTGGA TGG (reversed) Intergenic
No off target data available for this crispr