ID: 1009705030

View in Genome Browser
Species Human (GRCh38)
Location 6:67239032-67239054
Sequence CAGGGGACTCAGAGGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009705030_1009705042 27 Left 1009705030 6:67239032-67239054 CCCTGTCCCCTCTGAGTCCCCTG No data
Right 1009705042 6:67239082-67239104 TTCCCTTTATAAATTCAGTAAGG No data
1009705030_1009705041 -1 Left 1009705030 6:67239032-67239054 CCCTGTCCCCTCTGAGTCCCCTG No data
Right 1009705041 6:67239054-67239076 GGGATCTGCAGGACTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009705030 Original CRISPR CAGGGGACTCAGAGGGGACA GGG (reversed) Intergenic
No off target data available for this crispr