ID: 1009705041

View in Genome Browser
Species Human (GRCh38)
Location 6:67239054-67239076
Sequence GGGATCTGCAGGACTGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009705031_1009705041 -2 Left 1009705031 6:67239033-67239055 CCTGTCCCCTCTGAGTCCCCTGG No data
Right 1009705041 6:67239054-67239076 GGGATCTGCAGGACTGTTCAAGG No data
1009705029_1009705041 0 Left 1009705029 6:67239031-67239053 CCCCTGTCCCCTCTGAGTCCCCT No data
Right 1009705041 6:67239054-67239076 GGGATCTGCAGGACTGTTCAAGG No data
1009705035_1009705041 -8 Left 1009705035 6:67239039-67239061 CCCTCTGAGTCCCCTGGGATCTG No data
Right 1009705041 6:67239054-67239076 GGGATCTGCAGGACTGTTCAAGG No data
1009705036_1009705041 -9 Left 1009705036 6:67239040-67239062 CCTCTGAGTCCCCTGGGATCTGC No data
Right 1009705041 6:67239054-67239076 GGGATCTGCAGGACTGTTCAAGG No data
1009705030_1009705041 -1 Left 1009705030 6:67239032-67239054 CCCTGTCCCCTCTGAGTCCCCTG No data
Right 1009705041 6:67239054-67239076 GGGATCTGCAGGACTGTTCAAGG No data
1009705034_1009705041 -7 Left 1009705034 6:67239038-67239060 CCCCTCTGAGTCCCCTGGGATCT No data
Right 1009705041 6:67239054-67239076 GGGATCTGCAGGACTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009705041 Original CRISPR GGGATCTGCAGGACTGTTCA AGG Intergenic
No off target data available for this crispr