ID: 1009705042

View in Genome Browser
Species Human (GRCh38)
Location 6:67239082-67239104
Sequence TTCCCTTTATAAATTCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009705034_1009705042 21 Left 1009705034 6:67239038-67239060 CCCCTCTGAGTCCCCTGGGATCT No data
Right 1009705042 6:67239082-67239104 TTCCCTTTATAAATTCAGTAAGG No data
1009705031_1009705042 26 Left 1009705031 6:67239033-67239055 CCTGTCCCCTCTGAGTCCCCTGG No data
Right 1009705042 6:67239082-67239104 TTCCCTTTATAAATTCAGTAAGG No data
1009705030_1009705042 27 Left 1009705030 6:67239032-67239054 CCCTGTCCCCTCTGAGTCCCCTG No data
Right 1009705042 6:67239082-67239104 TTCCCTTTATAAATTCAGTAAGG No data
1009705039_1009705042 9 Left 1009705039 6:67239050-67239072 CCCTGGGATCTGCAGGACTGTTC No data
Right 1009705042 6:67239082-67239104 TTCCCTTTATAAATTCAGTAAGG No data
1009705038_1009705042 10 Left 1009705038 6:67239049-67239071 CCCCTGGGATCTGCAGGACTGTT No data
Right 1009705042 6:67239082-67239104 TTCCCTTTATAAATTCAGTAAGG No data
1009705029_1009705042 28 Left 1009705029 6:67239031-67239053 CCCCTGTCCCCTCTGAGTCCCCT No data
Right 1009705042 6:67239082-67239104 TTCCCTTTATAAATTCAGTAAGG No data
1009705040_1009705042 8 Left 1009705040 6:67239051-67239073 CCTGGGATCTGCAGGACTGTTCA No data
Right 1009705042 6:67239082-67239104 TTCCCTTTATAAATTCAGTAAGG No data
1009705036_1009705042 19 Left 1009705036 6:67239040-67239062 CCTCTGAGTCCCCTGGGATCTGC No data
Right 1009705042 6:67239082-67239104 TTCCCTTTATAAATTCAGTAAGG No data
1009705035_1009705042 20 Left 1009705035 6:67239039-67239061 CCCTCTGAGTCCCCTGGGATCTG No data
Right 1009705042 6:67239082-67239104 TTCCCTTTATAAATTCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009705042 Original CRISPR TTCCCTTTATAAATTCAGTA AGG Intergenic
No off target data available for this crispr