ID: 1009707884

View in Genome Browser
Species Human (GRCh38)
Location 6:67278163-67278185
Sequence CTCAGGAATCCTAGTTATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009707878_1009707884 19 Left 1009707878 6:67278121-67278143 CCACCAGAAGTATGGCAGCATCA No data
Right 1009707884 6:67278163-67278185 CTCAGGAATCCTAGTTATGGCGG No data
1009707879_1009707884 16 Left 1009707879 6:67278124-67278146 CCAGAAGTATGGCAGCATCAGCT No data
Right 1009707884 6:67278163-67278185 CTCAGGAATCCTAGTTATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009707884 Original CRISPR CTCAGGAATCCTAGTTATGG CGG Intergenic
No off target data available for this crispr